ID: 1106798976

View in Genome Browser
Species Human (GRCh38)
Location 13:33236367-33236389
Sequence CCAGGTGCGAGGAGTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106798968_1106798976 14 Left 1106798968 13:33236330-33236352 CCTTGTTAGTGTTTCTGTGGAGA 0: 1
1: 0
2: 1
3: 27
4: 1580
Right 1106798976 13:33236367-33236389 CCAGGTGCGAGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 133
1106798965_1106798976 26 Left 1106798965 13:33236318-33236340 CCTCCTCAAACGCCTTGTTAGTG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1106798976 13:33236367-33236389 CCAGGTGCGAGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 133
1106798964_1106798976 27 Left 1106798964 13:33236317-33236339 CCCTCCTCAAACGCCTTGTTAGT 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1106798976 13:33236367-33236389 CCAGGTGCGAGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 133
1106798966_1106798976 23 Left 1106798966 13:33236321-33236343 CCTCAAACGCCTTGTTAGTGTTT 0: 1
1: 0
2: 1
3: 9
4: 109
Right 1106798976 13:33236367-33236389 CCAGGTGCGAGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106798976 Original CRISPR CCAGGTGCGAGGAGTTCCCT GGG Intronic
900360744 1:2287773-2287795 CAAGGTGAGGGGAGATCCCTGGG - Intronic
901656349 1:10771958-10771980 ACAGGAGTGGGGAGTTCCCTGGG - Intronic
907781534 1:57571590-57571612 CCAGCTGGGAGGAGGGCCCTAGG - Intronic
918304376 1:183232648-183232670 TCAGGTGCTAGCAGATCCCTTGG + Exonic
919989619 1:202700185-202700207 CCAGGGGCTAGGTGCTCCCTGGG + Intronic
922722789 1:227907080-227907102 CGAGCTGCAAGGAGTTCCCCGGG + Intergenic
1069610469 10:69769329-69769351 CCAGCTTCTAGGAGTTTCCTGGG - Intergenic
1077022025 11:421164-421186 CCAGGCGCGTGGACTTCCCGGGG + Exonic
1077375400 11:2203177-2203199 CCATGTCCCAGGAGTGCCCTTGG + Intergenic
1082609366 11:55280044-55280066 CCAGGTGCACAGAGTACCCTGGG + Intergenic
1084083606 11:66844537-66844559 CAACGTCCAAGGAGTTCCCTGGG + Intronic
1084169574 11:67394254-67394276 CCAGGATCGAGGAGTCCCCAAGG + Intronic
1085474871 11:76783401-76783423 CCAGGTGAGTGCAGTTCCCCGGG + Intronic
1085519735 11:77130931-77130953 CCAGGTGTGGGAAGGTCCCTGGG + Intronic
1088954137 11:114603200-114603222 CCAGGTAATAGGAGTTACCTAGG - Intergenic
1088954179 11:114603482-114603504 CCAGGTAATAGGAGTTACCTAGG - Intergenic
1088954193 11:114603576-114603598 CCAGGTAATAGGAGTTACCTAGG - Intergenic
1088954200 11:114603623-114603645 CCAGGTAATAGGAGTTACCTAGG - Intergenic
1090419748 11:126566330-126566352 CCAGAGGCCAGGAGTTCCCAAGG - Intronic
1093317291 12:17667037-17667059 CAAGGAGCAAGGAGCTCCCTGGG + Intergenic
1097010900 12:55952929-55952951 CCAGGTGAGAGGAGCAGCCTTGG + Exonic
1097176076 12:57143683-57143705 CCAGGCGAGAGCAGTTGCCTTGG - Exonic
1099075790 12:78106686-78106708 CCAGGTGTGAGGAGTTTCTCTGG - Intronic
1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG + Intronic
1102072682 12:110034873-110034895 CCAGGTGCTGGGAATTCTCTGGG + Intronic
1102566882 12:113802864-113802886 CCAGGAGAGATGAGTTCTCTGGG - Intergenic
1103623648 12:122203718-122203740 CCAGGTGCGCGGAGCTCTCGGGG - Exonic
1106798976 13:33236367-33236389 CCAGGTGCGAGGAGTTCCCTGGG + Intronic
1107723299 13:43272327-43272349 CCCTGTGGGAGGATTTCCCTGGG + Intronic
1109745486 13:66617953-66617975 TCAGGTGGGAGGGGGTCCCTGGG + Intronic
1113005677 13:105699554-105699576 CCAGGTGCTAAGAGTTCACAGGG - Intergenic
1113557730 13:111252011-111252033 CAAAGTGGGAGGAGTGCCCTGGG + Intronic
1114255481 14:20998258-20998280 CCAGAGGCCAGGACTTCCCTAGG + Intergenic
1114854211 14:26418099-26418121 CCATGGGCCAGCAGTTCCCTAGG + Intergenic
1117276765 14:54201912-54201934 CCACGTGTGAGGCCTTCCCTAGG + Intergenic
1117378172 14:55134774-55134796 CAAGCTGCCAGCAGTTCCCTAGG + Intronic
1117564288 14:56977614-56977636 CCAGGTGAGAGGAGTTAGCGGGG - Intergenic
1118346879 14:64947383-64947405 CCAGGGGCAAGGAGAGCCCTGGG - Exonic
1119998482 14:79278515-79278537 CCAGGTGGGTGAAGTCCCCTGGG - Intronic
1122718297 14:103708098-103708120 CCAGGCGCATGGGGTTCCCTGGG + Intronic
1123814194 15:23960149-23960171 CCATGTGAGAGAAGTCCCCTTGG - Intergenic
1128680520 15:69648215-69648237 CCAGGTGAGAGCAGCTCCCACGG - Intergenic
1130652887 15:85772358-85772380 GCAGGTGCGATGAGGTGCCTAGG - Intronic
1130720177 15:86378814-86378836 CCAGGTTGGAGGAGTTCACCTGG + Intronic
1132335216 15:101044079-101044101 CCAGGAGCGGGGACTTGCCTGGG - Intronic
1133387268 16:5379890-5379912 CCAAGTGCAAGGAGTTACCCTGG - Intergenic
1134862795 16:17575558-17575580 GCCGGTGCCAGGAGCTCCCTGGG + Intergenic
1135064717 16:19299799-19299821 CCAGGTGTGATGTGTTCCATTGG + Intronic
1136692633 16:32046393-32046415 CCAGCTGCAAGGAGGTACCTGGG + Intergenic
1136793130 16:32989619-32989641 CCAGCTGCAAGGAGGTACCTGGG + Intergenic
1136876723 16:33864438-33864460 CCAGCTGCAAGGAGGTACCTGGG - Intergenic
1137400927 16:48153970-48153992 CCAGGAGTGAGGAGCTGCCTGGG + Intronic
1141282874 16:82644718-82644740 CCAGGTGACAGGAGTCCGCTGGG + Intronic
1141632235 16:85294403-85294425 CCAGCTGCGTGGTGTTCCATGGG + Intergenic
1142251286 16:88993189-88993211 CCAAGTGGGAGGAGTGTCCTGGG + Intergenic
1203095386 16_KI270728v1_random:1251310-1251332 CCAGCTGCAAGGAGGTACCTGGG + Intergenic
1142904402 17:3032751-3032773 CCAGGAGGGAGGAGTTCCTGAGG + Intronic
1144955063 17:19014980-19015002 CCAGGCGGGAGGGGTTCCCGGGG + Intronic
1145254309 17:21314347-21314369 CCAGGTGGGAGCAGCCCCCTCGG - Exonic
1151478135 17:74355183-74355205 CCAGGGGTGAGGAGTCCCCCGGG - Exonic
1151586464 17:75011873-75011895 CCAGGAGAGAGGGGGTCCCTCGG - Intergenic
1152098976 17:78289881-78289903 CCAGGGCAGAGGAGTTCCCGCGG + Intergenic
1152722878 17:81931470-81931492 CCAGGTGGGAGGAGTTGCCAGGG + Intergenic
1152814669 17:82400220-82400242 CCAGCTGCCAGGAGGCCCCTTGG + Intronic
1157313794 18:46572046-46572068 CCAGGTGCTGGGTGTGCCCTTGG - Intronic
1157476028 18:48024192-48024214 CCAGGTCCTTGGAGGTCCCTTGG + Intergenic
1158933292 18:62341937-62341959 CCAGTTTCGAGGACTGCCCTGGG + Intronic
1160496934 18:79381309-79381331 CCAGGTGCCAGTAGGCCCCTAGG + Intergenic
1163795981 19:19338167-19338189 CCAGCAGCCAGGAGTTCCCGAGG + Intronic
1166857285 19:45788957-45788979 GCAGGTGAGAAGAGTTGCCTGGG - Intronic
925265568 2:2564148-2564170 CCAGGTGAGAGCATTGCCCTGGG - Intergenic
925401387 2:3575681-3575703 CCAGGTGAGAGGGTTTCCCTGGG + Exonic
929990637 2:46783408-46783430 GCAGGTGAGAGGGTTTCCCTGGG - Intergenic
933419564 2:82028760-82028782 CCAGGTCAGTGGAGTTCCATGGG - Intergenic
934588978 2:95529399-95529421 CCAGGTGCACAGAGTACCCTGGG + Intergenic
945040345 2:205738748-205738770 CCGGGTGGGAGGACTTCCCAGGG + Intronic
945206842 2:207341598-207341620 CCTGCTGCGGAGAGTTCCCTTGG + Intergenic
948876724 2:240833346-240833368 CCAGGCCCGAGGGGTTCCGTGGG - Intergenic
948986881 2:241531041-241531063 CCGGGTCTGAGGAGTTTCCTGGG - Intergenic
1168930069 20:1614592-1614614 CCATGTGGGAGGAGCTCCCAAGG - Intronic
1170604285 20:17864020-17864042 CCAGGTGGGAGGGGTTGCCGGGG + Intergenic
1171012666 20:21517044-21517066 CCAGGAGCCAGGATTCCCCTAGG - Intergenic
1171444688 20:25195430-25195452 CCAGATTCAAGGGGTTCCCTTGG - Intergenic
1171605970 20:26826344-26826366 CCAGCTTGGAGGATTTCCCTTGG + Intergenic
1171649243 20:27474576-27474598 CCAGCTTGGAGGATTTCCCTTGG + Intergenic
1171678360 20:27911755-27911777 CCAGCTTGGAGGATTTCCCTTGG + Intergenic
1171681720 20:27962067-27962089 CCAGCTTGGAGGATTTCCCTTGG + Intergenic
1171686485 20:28033441-28033463 CCAGCTTGGAGGATTTCCCTTGG + Intergenic
1172165102 20:32894091-32894113 CCAGTTCAGATGAGTTCCCTAGG - Intronic
1175542970 20:59759747-59759769 CCAGATGTGGGCAGTTCCCTTGG - Intronic
1176231477 20:64035369-64035391 ACAGGTGACAGGAGTCCCCTAGG - Intronic
1180125911 21:45790216-45790238 CCAGGTGAGAGGTGGTCCCGAGG + Intronic
1182049689 22:27303198-27303220 TCAGGTGCTAGGAGATCCTTGGG - Intergenic
1183693359 22:39404016-39404038 CCAGGTGCGAGAAGGTGTCTTGG + Intronic
1184233420 22:43170413-43170435 CCATGTCCGAGGAGTCCTCTAGG - Intronic
1185057377 22:48588023-48588045 GCAGGTGCCAGGAGCCCCCTTGG + Intronic
954618846 3:51984368-51984390 CCAGCTGCCAGGAGTAACCTTGG - Intronic
961408661 3:126702866-126702888 TCTGGTGCAAGGAGTTTCCTGGG - Intergenic
961553172 3:127680494-127680516 CCAGGGGCCAGGAGCTCTCTTGG + Exonic
961661660 3:128471982-128472004 CCACGTGTGAGGGTTTCCCTCGG - Intergenic
963593956 3:147301647-147301669 CCAGGTTCAAGCAATTCCCTGGG - Intergenic
964980377 3:162670320-162670342 CCAGGTGGGAGAGGGTCCCTGGG + Intergenic
965261127 3:166487523-166487545 CCCACTTCGAGGAGTTCCCTTGG - Intergenic
970723978 4:19021129-19021151 CAAGGCTAGAGGAGTTCCCTGGG + Intergenic
975634718 4:76436145-76436167 CCTGGAGGGAGGAGCTCCCTGGG + Exonic
981781529 4:148436150-148436172 GCATGTCAGAGGAGTTCCCTGGG + Exonic
984451596 4:179910713-179910735 CCAGGTGGGAGGAGAAACCTTGG + Intergenic
984908444 4:184650094-184650116 CGAGCTGCGTGGAGTTCCCAAGG + Intronic
984940774 4:184930262-184930284 CCAGGTCCAAGGAGTACCCAGGG - Intergenic
985570780 5:643666-643688 CCAGGTGAGACGGGATCCCTGGG + Intronic
997691613 5:135831191-135831213 CCAGGTGTGAGGACTCCCCCTGG - Intergenic
999303929 5:150507899-150507921 CGAGGTGCCAGTGGTTCCCTGGG + Intronic
1002602574 5:180362366-180362388 CCAGGACTGAGGGGTTCCCTGGG - Intergenic
1003005634 6:2378461-2378483 ACAGGTGTGAAGAATTCCCTAGG - Intergenic
1006838842 6:37015398-37015420 CCAGGTGTCAGGAGATCCCCCGG - Intronic
1007257888 6:40541402-40541424 CCAGGTGGAATGTGTTCCCTGGG + Intronic
1008008183 6:46434694-46434716 ACAGATGAGAGGAGTTGCCTGGG - Intronic
1017967797 6:159281455-159281477 CCTGGGGTGAGGAGCTCCCTGGG + Intergenic
1019010679 6:168841645-168841667 CCAGGTGGCAGGAGGTGCCTAGG + Intergenic
1020027809 7:4911335-4911357 ACAGGTGACAGGACTTCCCTGGG - Intronic
1021330954 7:19339203-19339225 CCAGGTGGGAGGGGGTCCCTGGG + Intergenic
1022800852 7:33775959-33775981 CCAGGTTCTTGGAGTTCTCTTGG + Intergenic
1030161253 7:106510545-106510567 GCTGGAGCGAGGAGTTCCATGGG - Intergenic
1033589080 7:142795804-142795826 CCAGGTGGGAAGAGTTCTCTGGG + Intergenic
1033866785 7:145698695-145698717 GCAGGTGTAAGGAGGTCCCTGGG + Intergenic
1035706203 8:1677302-1677324 CCAGGTTCTAGGAGGTCTCTTGG - Intronic
1038532720 8:28331553-28331575 CCAGGTGAGAGGAGTTCAGGAGG - Intronic
1039915644 8:41858557-41858579 TCACGTCCGAGCAGTTCCCTTGG - Intronic
1042863763 8:73338818-73338840 CCACGTGTGAGGATTTCTCTAGG - Intergenic
1052998694 9:34565506-34565528 ACAGCTGCCAGGAGTTCCCTAGG - Intronic
1053388089 9:37711119-37711141 CCAGGTGGGAGGAGCTCTCTGGG + Intronic
1057895614 9:98906508-98906530 CCATGTGCGATGAGTTCCTCAGG + Intergenic
1059465623 9:114467136-114467158 CCAGGTGATAGGAGACCCCTGGG - Intronic
1060918486 9:127404879-127404901 CCACGTGCGAGGAGTTGCCAGGG - Exonic
1062125042 9:134855638-134855660 CCAGGTGTGAGGAGTTCCACGGG + Intergenic
1062517386 9:136943475-136943497 CCTGGTACGAGGAGTTCCAGCGG - Exonic
1186621342 X:11243613-11243635 CAAGGTGAGATGAGTTCCTTTGG - Intronic
1188152895 X:26701008-26701030 CCAGGACTGAGGGGTTCCCTGGG - Intergenic
1188349691 X:29112891-29112913 CCAGGTTCAAGCAGTTCTCTGGG + Intronic
1189854830 X:45213985-45214007 CTGGGTGGGAGGGGTTCCCTTGG - Intergenic
1199138971 X:144287707-144287729 CCCAGTGCGAGGAGTTGCCTGGG + Intergenic
1200124652 X:153807553-153807575 TCAGGTGCGAGAAGTGCCCCCGG - Intronic
1201688644 Y:16736656-16736678 CCAGGTTGGAGGAGTTCTCCTGG + Intergenic