ID: 1106802523

View in Genome Browser
Species Human (GRCh38)
Location 13:33270949-33270971
Sequence CTCTGCTTGTGGGAGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106802523_1106802526 22 Left 1106802523 13:33270949-33270971 CCTGCACACTCCCACAAGCAGAG 0: 1
1: 1
2: 3
3: 23
4: 291
Right 1106802526 13:33270994-33271016 TAAATAGCAGTCAAGAAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 226
1106802523_1106802527 23 Left 1106802523 13:33270949-33270971 CCTGCACACTCCCACAAGCAGAG 0: 1
1: 1
2: 3
3: 23
4: 291
Right 1106802527 13:33270995-33271017 AAATAGCAGTCAAGAAGCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 272
1106802523_1106802529 29 Left 1106802523 13:33270949-33270971 CCTGCACACTCCCACAAGCAGAG 0: 1
1: 1
2: 3
3: 23
4: 291
Right 1106802529 13:33271001-33271023 CAGTCAAGAAGCCAGGGAGGAGG 0: 1
1: 0
2: 0
3: 44
4: 427
1106802523_1106802528 26 Left 1106802523 13:33270949-33270971 CCTGCACACTCCCACAAGCAGAG 0: 1
1: 1
2: 3
3: 23
4: 291
Right 1106802528 13:33270998-33271020 TAGCAGTCAAGAAGCCAGGGAGG 0: 1
1: 0
2: 2
3: 16
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106802523 Original CRISPR CTCTGCTTGTGGGAGTGTGC AGG (reversed) Intronic
900154997 1:1200371-1200393 CGCTGCTGGTGAGAGTGTGCTGG - Intergenic
900215663 1:1480264-1480286 GTCTGTGTGTGGGGGTGTGCAGG - Intronic
900736976 1:4305198-4305220 CCCTGCTTGGGGGAGTGGCCAGG + Intergenic
900908608 1:5578070-5578092 CTCTGTGTGTGGGTGTGTGTGGG + Intergenic
901060101 1:6467969-6467991 CTCTTCCTGTGGGAGCCTGCAGG + Exonic
901728163 1:11258639-11258661 CTGTGGTGGTGGGAGTGGGCTGG + Intronic
901911776 1:12464616-12464638 CTCTCCTTGTTGGAGTGCGCTGG + Intronic
904259590 1:29280618-29280640 CTCTGCTGGGGAGAGGGTGCTGG + Intronic
905215220 1:36401809-36401831 CTGTGCTGGTGGGAGCCTGCAGG + Intergenic
905302002 1:36991898-36991920 CTTGGCTTGGGGCAGTGTGCTGG + Intronic
905398042 1:37680094-37680116 CTATGCCTGTGTGAGTGTGGTGG - Intergenic
905870392 1:41400367-41400389 CTCTGCTTCTGGGGGTTGGCTGG - Intergenic
905893189 1:41529659-41529681 GTGTGGTTGTGGGAGTGTGTAGG - Intronic
908679290 1:66641816-66641838 CTCAAATTGTGGGAGAGTGCTGG - Intronic
908679550 1:66645232-66645254 CTATGTTTCTGGGACTGTGCCGG - Intronic
909256983 1:73437023-73437045 CTATGCATGTGGGAGTATGTGGG + Intergenic
909813349 1:79959358-79959380 CTCTGCTTCTGTGACTTTGCAGG + Intergenic
910793691 1:91076358-91076380 CTCTGCTTGGGTGAGTGTTATGG + Intergenic
911301492 1:96179790-96179812 CTCTGCTTCTGGGACTAGGCTGG - Intergenic
918114296 1:181483672-181483694 TTCTGCTTGTTGCTGTGTGCGGG + Intronic
918358056 1:183724575-183724597 CTCTGCTTGTGGAAGGGGGAGGG + Intronic
921743024 1:218708036-218708058 TTCTGCTTCTGGGAGGCTGCGGG - Intergenic
922036691 1:221855085-221855107 CTCTGCCTGAGGGAATGAGCAGG - Intergenic
922917166 1:229268317-229268339 CTCTGCTCGTGGGAGTGGACAGG + Intergenic
1062813365 10:481833-481855 GTCTGCCTGTGGGGGTGGGCCGG - Intronic
1063461214 10:6216035-6216057 CTCTGCTTGTCGGGGCGTGTCGG + Intronic
1065366159 10:24938886-24938908 CTCTGCTGATGGGGGTGTGTGGG - Intronic
1065646073 10:27835123-27835145 GCCTGCTGGTGGGACTGTGCCGG - Intronic
1067427739 10:46222244-46222266 CTCTGAATGAGGGAGTGGGCAGG - Intergenic
1067583156 10:47458133-47458155 CTCTGAATGAGGGAGTGGGCAGG - Intergenic
1069639472 10:69945458-69945480 CTCTGCTGGAGGGAGAGTGAGGG + Intronic
1069655885 10:70088133-70088155 CTGTGTGTGTGTGAGTGTGCAGG - Intronic
1069655888 10:70088190-70088212 CTGTGTGTGTGTGAGTGTGCAGG - Intronic
1069655891 10:70088247-70088269 CTGTGTGTGTGTGAGTGTGCAGG - Intronic
1069688824 10:70336230-70336252 CAATGCTTGTGGGAATCTGCTGG + Intronic
1070651269 10:78238501-78238523 CTCTACCTGTGGGTGTGTCCAGG + Intergenic
1072283731 10:93893900-93893922 GTCTCCTTGGGGGAGGGTGCGGG + Intergenic
1073680430 10:105697735-105697757 CTTTGTTTGAGGTAGTGTGCTGG - Intergenic
1074157544 10:110811916-110811938 CTCTCCTCCTGGGGGTGTGCGGG - Intronic
1074270512 10:111949144-111949166 CTCTGCTTCTGGGAGTTGGACGG - Intergenic
1075023588 10:118968116-118968138 CTCTGGCTGAAGGAGTGTGCTGG - Intergenic
1076934541 10:133558710-133558732 CTCTGCTTGTGGGAGTGTTCAGG - Intronic
1077058989 11:609572-609594 CTCTGCGAGTGGGAGGGTACAGG + Exonic
1077597635 11:3547625-3547647 CTTTGCTGGTGGCAGTGGGCTGG - Intergenic
1078480292 11:11669359-11669381 CTCTCCTATTGGGAGTGTGATGG + Intergenic
1080433815 11:32221716-32221738 CTCTGCCTGTGGGAGGGTCAGGG + Intergenic
1080644940 11:34181590-34181612 CTTAGCTTGTGGGTGTGTCCAGG - Intronic
1080702326 11:34654449-34654471 CTCTGCCTGTTGCAGTGTGCAGG - Intronic
1080843286 11:36004470-36004492 CTCTGCTTCTGTGAGTCTGCAGG + Intronic
1082857577 11:57822258-57822280 CTCTGTTTTTGGCAGTATGCTGG + Intergenic
1083003601 11:59320746-59320768 CTCAGTCTGTGGGAGTTTGCTGG + Intergenic
1084253734 11:67923531-67923553 CTTTGCTGGTGGCAGTGGGCTGG - Intergenic
1084785045 11:71437364-71437386 CTCTGATTTGGGGAGAGTGCTGG - Intronic
1084819143 11:71672395-71672417 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
1085734312 11:79025907-79025929 CTCTGCTTGTGAGTGTATGTGGG + Intronic
1086829255 11:91539748-91539770 CTCTGTATGTGGCACTGTGCTGG - Intergenic
1086981316 11:93200763-93200785 ATCTGCTTGTGTGTCTGTGCAGG + Intergenic
1087744703 11:101930147-101930169 CTCTTCTTATGGGTGTGTGTTGG + Intronic
1087887634 11:103498218-103498240 CTCTGCTTGTGGAAAGGTGAGGG + Intergenic
1090049307 11:123363306-123363328 CACTGGTTGTGTGGGTGTGCTGG - Intergenic
1091631764 12:2166858-2166880 TTCTGAGTGTGGGAGTGTGCAGG + Intronic
1092166840 12:6347815-6347837 CTCCTCTGGTGGGAGGGTGCTGG - Exonic
1092174575 12:6394372-6394394 CTCTGCGTGTGGCACTGTGCGGG - Intergenic
1092423808 12:8356918-8356940 CTTTGCTGGTGGCAGTGGGCTGG - Intergenic
1095286164 12:40413214-40413236 CTCTGCTTCAAGCAGTGTGCAGG + Intronic
1097779301 12:63685322-63685344 GTCAGTCTGTGGGAGTGTGCAGG - Intergenic
1098144360 12:67483854-67483876 CTGTGCTTGGGGCACTGTGCAGG + Intergenic
1098564887 12:71922728-71922750 CTATGTTTGTGGGAATGTGGAGG + Intronic
1098894983 12:76048864-76048886 ATCTGGTTGTAGGAGTGTTCGGG - Intronic
1100082567 12:90871061-90871083 TTCTGCTTGTGAGAGCCTGCAGG + Intergenic
1101073039 12:101096662-101096684 CTCAGCTTGGGGAGGTGTGCAGG - Intronic
1105299250 13:19117878-19117900 CTCTGCCTGTGGTAGGGGGCTGG - Intergenic
1105453880 13:20523665-20523687 CTCTGCCTCTGGGACAGTGCTGG - Intronic
1105898303 13:24736551-24736573 CTCTGCTTCTGGGGGTGAGTTGG - Intergenic
1106802523 13:33270949-33270971 CTCTGCTTGTGGGAGTGTGCAGG - Intronic
1107172984 13:37365364-37365386 CTCTGTTTGTGTGTGTGTGTGGG + Intergenic
1108433634 13:50379895-50379917 CACTGTTTGTGGCAGTATGCAGG + Intronic
1109100654 13:58180603-58180625 CTCTGCTTGTGGGAAGGGGAGGG - Intergenic
1110318077 13:74133870-74133892 CTCTGCGTGTGCGTGTGCGCGGG - Intronic
1110469521 13:75843206-75843228 CTCTGCTTTTGGGGGTTGGCTGG + Intronic
1110886041 13:80636820-80636842 CTCTGCTTGTGGAAATGAGAGGG - Intergenic
1112580954 13:100675517-100675539 CTCTGAGAGTGGGAGTGTGGTGG - Intergenic
1113444270 13:110353449-110353471 CTCTGCTGGAGGGAGTGGCCAGG + Intronic
1113734235 13:112665877-112665899 GTGTGCATGTGTGAGTGTGCGGG + Intronic
1113820923 13:113212004-113212026 CTGTGCTTGTGGGTGTGTGGTGG + Intronic
1117173501 14:53124965-53124987 CTCTGCGTGTGTGGGTGTGTGGG + Intronic
1119275114 14:73348378-73348400 CTCTGCTTTAGAGACTGTGCAGG - Intronic
1119920999 14:78445933-78445955 TCCTGCTTGTGGGAGAGTGGGGG + Intronic
1120113169 14:80582134-80582156 CTCTGCTTCTGGGCATTTGCTGG - Intronic
1120511936 14:85425764-85425786 CTCTGCTTTTGTGAGTTTGGTGG + Intergenic
1121328145 14:93033795-93033817 CTGTGCATGTGGGTGTGTGGTGG + Intronic
1121456917 14:94044175-94044197 TCCTGCTTGTGGGGGTGTGTGGG + Intronic
1122090093 14:99332357-99332379 GTGTGCTTGTGTGTGTGTGCTGG - Intergenic
1122090130 14:99332900-99332922 GTGTGCTTGTGTGTGTGTGCTGG - Intergenic
1122090153 14:99333241-99333263 GTGTGCTTGTGTGTGTGTGCTGG - Intergenic
1124149039 15:27160245-27160267 CACTGCTTGTGGGTGAGTTCTGG + Intronic
1124490375 15:30151553-30151575 CTCAGCTTGTTGGAGATTGCAGG + Intergenic
1124596568 15:31096537-31096559 CTGTGCTTTTCGGAGTGAGCTGG - Intronic
1124753157 15:32386776-32386798 CTCAGCTTGTTGGAGATTGCAGG - Intergenic
1124836974 15:33204755-33204777 CTGTGATTGAGGGTGTGTGCAGG + Intergenic
1124854507 15:33374419-33374441 CTATGCGTGTGGGTGTGTGTGGG - Intronic
1124974896 15:34522476-34522498 CTCAGCTTGTTGGAGATTGCAGG - Intergenic
1125537791 15:40452587-40452609 CTCTGCTTGTGGGAGTGATCTGG + Intronic
1125538060 15:40454141-40454163 CTCTGCTTGTGGGAGTGATCTGG + Intronic
1126838208 15:52689145-52689167 CTCTGCATGTTGGATTTTGCTGG - Intronic
1128683524 15:69667826-69667848 CGGTGCTGGTGGGAGGGTGCTGG + Intergenic
1129075270 15:72989632-72989654 CTCAGCTTGTGGGATTGTTAGGG - Intergenic
1129449740 15:75644478-75644500 CTCTGCTGGTGGCAGCCTGCAGG - Intronic
1131426242 15:92347510-92347532 CTCTCCTTGGAGGAGTGTGATGG + Intergenic
1132503957 16:297580-297602 CTCTGCTGGAGGGAGTGGACTGG - Intronic
1132730106 16:1356885-1356907 GTCTGCGGGCGGGAGTGTGCGGG + Intronic
1132730118 16:1356927-1356949 GTCTGCGGGCGGGAGTGTGCGGG + Intronic
1132804700 16:1770033-1770055 CTCTGGTTGGGGGTGGGTGCGGG - Exonic
1133374469 16:5273022-5273044 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
1133403736 16:5507061-5507083 CTCTGCTGTTGGTTGTGTGCAGG + Intergenic
1136654054 16:31699100-31699122 CTCTGCTTCTGGGTGTCAGCTGG - Intergenic
1136683991 16:31983565-31983587 CTCAGCTGGTGAGAGGGTGCTGG + Intergenic
1136692782 16:32047778-32047800 CTCTGCGTGTGTGTGTGTGGGGG + Intergenic
1136784617 16:32927117-32927139 CTCAGCTGGTGAGAGGGTGCTGG + Intergenic
1136793278 16:32991003-32991025 CTCTGCGTGTGTGTGTGTGGGGG + Intergenic
1136876576 16:33863054-33863076 CTCTGCATGTGTGTGTGTGTGGG - Intergenic
1136885166 16:33926689-33926711 CTCAGCTGGTGAGAGGGTGCTGG - Intergenic
1137329668 16:47479872-47479894 CTCTGCTTCTGTCAGTTTGCTGG + Intronic
1139231802 16:65290605-65290627 CTCTTCTTGTGTGTGTGTGGTGG - Intergenic
1139581790 16:67878186-67878208 CTCTCCTGATGGGACTGTGCTGG + Exonic
1203087276 16_KI270728v1_random:1191123-1191145 CTCAGCTGGTGAGAGGGTGCTGG + Intergenic
1145403961 17:22569809-22569831 CTCTGCCTGTGGCAGTGGTCTGG - Intergenic
1147144917 17:38479268-38479290 CTCAGCTGGTGAGAGGGTGCTGG + Intronic
1147791213 17:43015328-43015350 CTGTGCTTGTGTGTGTGTGGCGG - Exonic
1147867382 17:43562127-43562149 CTCTGCTTGGGGAAGTGGGGAGG + Intronic
1148135830 17:45291029-45291051 CTCTCCTAGAGGGAGTGGGCTGG - Intronic
1148572187 17:48678798-48678820 CTATGCTTCTGGAAGGGTGCAGG - Intergenic
1148690607 17:49524859-49524881 CACTCTTTGTGGGAGTGGGCAGG - Intergenic
1148743721 17:49907230-49907252 CTCAGCTTCTGGAAGGGTGCAGG - Intergenic
1148775983 17:50095943-50095965 GTCTGCTGGTGGGAGTGAGGAGG + Intronic
1148835097 17:50461746-50461768 CTCTGCTTGTCAGAGTCTGACGG + Intronic
1150925566 17:69528400-69528422 TTTTCCTTGAGGGAGTGTGCTGG + Intronic
1151678329 17:75611140-75611162 CTCTGTTTGTTCGAGTGTCCAGG + Intergenic
1154340763 18:13500321-13500343 CTCTGCCCGTGGGGCTGTGCGGG + Intronic
1154377980 18:13824336-13824358 CGCTGCATGTGGAAGTGAGCGGG + Intronic
1155227885 18:23745807-23745829 CTATGATTGTGGGAGTTTGGTGG + Intronic
1155877349 18:31102629-31102651 AACTGCTTGTGGGTGTGTGTAGG - Intergenic
1157283278 18:46360141-46360163 CTCTGTTTGGAGGAGTGAGCTGG - Intronic
1159778372 18:72630546-72630568 CTCTGCATGTGTGTGTGTGTGGG - Intronic
1160716124 19:577634-577656 TTCAGCTTGTGGGAGAGTGATGG - Intronic
1161393778 19:4034260-4034282 CCCTGCCTGTGGGGGTGGGCCGG + Intronic
1162464556 19:10832129-10832151 CTGTGCACGTGGGGGTGTGCAGG - Intronic
1163828095 19:19535046-19535068 CTCTGCTTCCGGGAGAGAGCGGG - Exonic
1165348976 19:35266553-35266575 AACAGCTGGTGGGAGTGTGCTGG + Intronic
1165987984 19:39787313-39787335 CTCTGGTTGGGGGAGTGTGGTGG - Intergenic
1166008223 19:39922031-39922053 CCCTGATTTTGTGAGTGTGCAGG - Intronic
1166373467 19:42314707-42314729 CTCAGCCTGGGGGAGTGGGCAGG + Intronic
1166740457 19:45111699-45111721 CTCTGCCTGTGGGTGGGTGGAGG + Intronic
1166801880 19:45462888-45462910 CTCTGCTTGGGGGAGACGGCTGG - Intronic
1167741933 19:51329116-51329138 CTCTGTTTGTGTGTGTGTGGGGG + Exonic
1167793704 19:51695623-51695645 CTCTCCATGTGGGGGTGTGCAGG + Intergenic
1167980124 19:53268927-53268949 CTCTAATTCTGAGAGTGTGCAGG - Intergenic
1167985765 19:53313896-53313918 CTCTAATTCTGAGAGTGTGCAGG + Intergenic
925175341 2:1779559-1779581 CTCTGCTGGTGAGGCTGTGCTGG - Intergenic
925175351 2:1779643-1779665 CTCTGCTGGTGAGGCTGTGCTGG - Intergenic
925175370 2:1779811-1779833 CTCTGCTGGTGAGTGTCTGCTGG - Intergenic
925175470 2:1780819-1780841 CTCTGCTGGTGAGGCTGTGCTGG - Intergenic
925278186 2:2665293-2665315 CTCTGTCTGTGTGAGTGAGCTGG - Intergenic
925802061 2:7611124-7611146 GCATGCATGTGGGAGTGTGCAGG + Intergenic
927240300 2:20915076-20915098 CTCTCCTTGTGGGTGGGTGAGGG + Intergenic
927482583 2:23465908-23465930 TTCTGCTTGTGGGTGTGTGATGG + Intronic
928169694 2:28995301-28995323 CTCTGCTTTTGGGAGCTGGCTGG + Intronic
928808960 2:35198614-35198636 CTCTGCTTCTGTGACTTTGCAGG - Intergenic
929218146 2:39437214-39437236 CTCTCCTTGTGGGTGTGACCAGG - Exonic
929331450 2:40686321-40686343 CTCTGCTTCTGGGGGTTAGCTGG + Intergenic
932308592 2:70721787-70721809 ATCTGCATGTGGGATTGGGCTGG - Intronic
934025941 2:88001715-88001737 ATCTGCAGGTGGTAGTGTGCCGG + Intergenic
934512482 2:94956919-94956941 CTCTGCTTTTGGGAACATGCTGG + Intergenic
934612432 2:95751294-95751316 CTGTTTTGGTGGGAGTGTGCTGG - Intergenic
935217304 2:100984364-100984386 CTCTACTTTTGGGGGTGGGCTGG - Intronic
935753016 2:106255667-106255689 CTCTGCATGTGGGTGAGTGAAGG - Intergenic
935913436 2:107923200-107923222 CTCTGCATGTGGGTGAGTGAAGG - Intergenic
944835344 2:203573763-203573785 GTCTGGATGTGGGAGTGTGAAGG + Intergenic
946560785 2:220910347-220910369 TGCTGCTTATGGGAGTGTGTAGG + Intergenic
947100689 2:226618166-226618188 CTGTGCTTGTGTGAGTGTGCTGG - Intergenic
948097138 2:235344282-235344304 GTGTGCCTGTGTGAGTGTGCAGG - Intergenic
948734162 2:239988665-239988687 CTCTGCTTTTGTGAGTGGCCAGG - Intronic
1168806027 20:672815-672837 CTCAGCGTGTGTAAGTGTGCTGG - Intronic
1169213552 20:3781078-3781100 GTGTGCTTGTGGGAGTGGGGAGG - Intronic
1170406409 20:16042665-16042687 TTCTCAGTGTGGGAGTGTGCAGG - Intronic
1171030149 20:21669669-21669691 CTCTGCTTGGGGCAGTGACCTGG - Intergenic
1171373728 20:24677890-24677912 CTCAGCTTGTGGGGGTGGGTGGG - Intergenic
1172412800 20:34738670-34738692 CTCTGCGTGAGGCAGTGTGTTGG + Intronic
1172749535 20:37240557-37240579 CTCTGCTTGCTGGAGCCTGCTGG + Intronic
1173204161 20:40979674-40979696 CTCTGCTTATGGAAGTGGGAGGG - Intergenic
1173568295 20:44057850-44057872 CTCTGCTTCTGGGAGTTGGATGG + Intronic
1175465761 20:59190644-59190666 CTCTGCATGTGGCACTGTGCTGG + Intergenic
1176099825 20:63359867-63359889 CTCTGTGTGTGTGTGTGTGCCGG + Intronic
1176113001 20:63418996-63419018 GTCTGCTGTTGGGTGTGTGCAGG - Intronic
1177238370 21:18423241-18423263 CTCTGCATTTGGGAGTGGGCAGG - Intronic
1178761556 21:35407610-35407632 CTCTGCTTCAAGCAGTGTGCTGG + Intronic
1179325552 21:40339768-40339790 GACTGTTTGTGGGAGTGAGCGGG - Intronic
1179648822 21:42793372-42793394 TTCTGCTTGTAAGAGTGTCCAGG - Intergenic
1180112866 21:45672422-45672444 TTCTGCTTGTGGAAGTTTGGAGG + Intronic
1181630883 22:24150733-24150755 CTCCGCTGGTGGAAGAGTGCTGG + Intronic
1182970557 22:34570872-34570894 CTGTGGTTGTGGGAGGGGGCTGG - Intergenic
1183381907 22:37494368-37494390 ATCTGCCTGGGGGACTGTGCTGG - Intronic
1183720917 22:39560798-39560820 CTCTGGGAGTGTGAGTGTGCAGG + Intergenic
1183967013 22:41447921-41447943 CTCTGCCTCTGTGAGTGTGCGGG + Intergenic
949861773 3:8511900-8511922 CTCAACTTGGGGGAGTTTGCTGG - Intronic
949903741 3:8840965-8840987 GGCTGCTTGTGGGAGTAAGCAGG + Intronic
950006245 3:9692863-9692885 GTCTGCTTGTGGGTGGGAGCAGG + Intronic
950030085 3:9846443-9846465 GTCTGCTTGTGAGGGAGTGCTGG + Intronic
950752809 3:15144260-15144282 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
952981462 3:38739394-38739416 CTGTCCTTGTGGGAGGGAGCAGG - Intronic
953543189 3:43840821-43840843 CTCTGGTTGCAGGAGTGTGCTGG + Intergenic
955664599 3:61337149-61337171 CTCTTCTGGTGAGAGTGAGCGGG - Intergenic
957067804 3:75540003-75540025 CTTTGCTGGTGGCAGTGGGCTGG - Intergenic
959590560 3:108075410-108075432 CTATGTTTGTGGGAGTTTGAAGG - Intronic
960849066 3:122033181-122033203 CTCTGCTGGTGGGTGTGAGATGG + Intergenic
961285352 3:125797977-125797999 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
961567226 3:127772503-127772525 CTTTGCATGCGGTAGTGTGCAGG - Intronic
961810035 3:129516560-129516582 CTCTGTGTGTGTGTGTGTGCAGG - Intronic
961810063 3:129516838-129516860 CTCTGTGTGTGTGTGTGTGCAGG - Intronic
962292619 3:134149223-134149245 CTCAGCTTCTGGGAGGGGGCAGG - Intronic
963482182 3:145890071-145890093 CTCAGCTTGTGGGGCTGGGCTGG - Intergenic
965253461 3:166371715-166371737 CTCTGTTTGTGAGGGTGTGAGGG + Intergenic
967135416 3:186508908-186508930 CTGAGCCTGTGTGAGTGTGCAGG - Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967655023 3:192037228-192037250 CTCTGTGTGTGTGAGTGTGTAGG + Intergenic
967926282 3:194650981-194651003 CTCTGCCTGTGTGACTGTCCTGG - Exonic
969438458 4:7202103-7202125 CTGTGCTTGTGGGAACCTGCTGG - Intronic
969718588 4:8880613-8880635 CTCGGCTTGTGGGGCTGTGGGGG - Intergenic
969741709 4:9033158-9033180 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
969801076 4:9566055-9566077 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
971920565 4:32933803-32933825 CTCTTCTTTTGAGAGTGTGCAGG - Intergenic
972092031 4:35298870-35298892 CTCTGCTTTTAGTATTGTGCAGG + Intergenic
975710912 4:77158412-77158434 CGCTCCTTGTCGGGGTGTGCTGG + Intronic
975930057 4:79510287-79510309 CTCTGTTTCTGGGAGTTGGCTGG + Intergenic
976288729 4:83395936-83395958 CTTTTCTTGTGGGTGTGTGGAGG + Intergenic
976722107 4:88178806-88178828 CTCTGCTTGTGGAAATGAGAGGG + Intronic
977393051 4:96437563-96437585 CACTGGTTGTGGGAGTGTCCTGG - Intergenic
980164590 4:129209916-129209938 CTCTGGTTGTGGGACTGGGCTGG + Intergenic
980192881 4:129547524-129547546 CCCTACTTGTTGGAGTGTGTAGG + Intergenic
981578053 4:146225560-146225582 CTCTGCTTTTAGGAGTGTCTTGG - Intronic
981937172 4:150250504-150250526 CCCTGCTCCTGGGAGTGTGTGGG - Intronic
982134061 4:152257272-152257294 CTGTGCTTGTGCTAGTGTGGAGG + Intergenic
983397409 4:167217549-167217571 CTCTCCTGGTGGGGGTGTCCTGG + Intronic
985695270 5:1336640-1336662 CTCTGTTTGCTGGAGTTTGCTGG - Intronic
986534729 5:8775372-8775394 CTCTGCAGGTGGAAGTGTGAGGG - Intergenic
987428923 5:17807531-17807553 CTTTGAGTGTGGGATTGTGCAGG + Intergenic
987537497 5:19207344-19207366 CACTGCTCCTGGGACTGTGCTGG - Intergenic
990539274 5:56756368-56756390 CTCTGCTTATGTGTGTATGCAGG + Intergenic
992317391 5:75570871-75570893 CTCTGCCTCTGTGAGTATGCAGG + Intronic
995561789 5:113389725-113389747 CTGTGCATGTGGTGGTGTGCTGG - Intronic
1001264729 5:170265542-170265564 CTCGGCTCGTGGTAGTGAGCAGG + Intronic
1001854406 5:174998601-174998623 CTTTGCTTCTGGGAGTTTGCTGG + Intergenic
1003036845 6:2647548-2647570 CACTGCTATTGGGAGAGTGCTGG + Intergenic
1003316219 6:5014418-5014440 CTCTGCTTCTGGGGGTGAGCTGG + Intergenic
1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG + Intergenic
1003891199 6:10565268-10565290 CCCTGCTTGTGGGCAAGTGCTGG + Intronic
1006842064 6:37035187-37035209 CTCTGCATCTGGGAGCTTGCTGG - Intergenic
1006963282 6:37955952-37955974 CTGTGCTTGTGGGTGTGGGGAGG + Intronic
1007415715 6:41690056-41690078 CTCTGGCTTGGGGAGTGTGCTGG + Intronic
1007975591 6:46098029-46098051 CTCAGCATGGAGGAGTGTGCAGG + Intergenic
1008280641 6:49591896-49591918 CTCTTCTTGAAGGAGTGAGCTGG - Intergenic
1008728552 6:54452177-54452199 CTCTGCTTTTGGGAGAATCCAGG + Intergenic
1010589800 6:77699653-77699675 CTCTGCTTTTTGGAGTTTCCAGG + Intronic
1014044323 6:116866888-116866910 ATCTGCTTGTCCCAGTGTGCTGG + Intergenic
1014230785 6:118899540-118899562 CCCTGCATCTGGAAGTGTGCTGG + Intronic
1021442231 7:20689497-20689519 TTCTGCATGTGGGAGGGTGCAGG + Intronic
1022143019 7:27509526-27509548 CTCTGCTTCTTGGAGTGCTCTGG + Intergenic
1022985218 7:35647298-35647320 CTCTGCTTGGAGGAGTGGGAAGG - Intronic
1023987757 7:45107100-45107122 CTCTGCATTTGGGAGTGGGCAGG - Intronic
1024729178 7:52235652-52235674 CTCTGCCTCTGGGACTGTGATGG - Intergenic
1025211234 7:57020488-57020510 GTCTGGTTGTGGGAGTGGGGTGG - Intergenic
1025239452 7:57258877-57258899 CTCTGTTTCTGAGAGTGAGCTGG + Intergenic
1028266520 7:88733247-88733269 CTCTGCTTGTGGAAATGGGAGGG - Intergenic
1032501140 7:132400781-132400803 CACAGCTTGTGGGAGACTGCAGG + Intronic
1032581182 7:133105079-133105101 CTCTGATTGTGGTAATGGGCAGG - Intergenic
1032964181 7:137076671-137076693 TTCTGCTGGTGAGAGAGTGCTGG + Intergenic
1033282733 7:140017474-140017496 CTCTGCCTCTGGGGCTGTGCAGG + Intronic
1033353123 7:140578386-140578408 CTCTGCCTGTGGGAGACTACAGG + Intronic
1033722223 7:144073823-144073845 CCATGCATGTGGAAGTGTGCTGG - Intergenic
1034272766 7:149811376-149811398 CTCCTCTTCTGGGAGTTTGCTGG + Intergenic
1034470102 7:151250332-151250354 CTCTGTGTGTGGGGGTGTGTGGG - Intronic
1034494749 7:151412747-151412769 CCGTGCTTGTGAGAGTCTGCAGG - Intergenic
1035690444 8:1556292-1556314 CTCTGCTCCTGTGGGTGTGCAGG + Intronic
1035820042 8:2580869-2580891 CGCTTGTGGTGGGAGTGTGCAGG + Intergenic
1036253898 8:7188655-7188677 CTTTGCTGGTGGTAGTGGGCTGG - Intergenic
1036363595 8:8098824-8098846 CTTTGCTGGTGGTAGTGGGCTGG + Intergenic
1036630494 8:10511010-10511032 CTCTGCGTGTTGGAATGTGGGGG - Intergenic
1040306170 8:46212964-46212986 TTTTGCTTGTGGGAGTTTTCTGG - Intergenic
1043983525 8:86667634-86667656 CTCTGCCTCTGGGAGGCTGCAGG + Intronic
1044429898 8:92096085-92096107 CTCTGAGTGTGTGAATGTGCAGG - Intronic
1048441227 8:134460440-134460462 TTGTGTCTGTGGGAGTGTGCGGG + Intergenic
1049822995 8:144647463-144647485 CTTTCCTTGTGGGAATGTTCTGG - Intergenic
1049844697 8:144794152-144794174 CTCTGCTTGTGCTAGTGGCCTGG + Intergenic
1049985376 9:946170-946192 CTCTCCTTGTGCAATTGTGCTGG + Intronic
1050259497 9:3826657-3826679 TTCCGCTTGTGGGACTGTGGAGG + Intronic
1052857276 9:33415265-33415287 CTCTGCCTGTGGGGGCGTCCTGG + Intergenic
1053411909 9:37921243-37921265 CTCAGGTTGGGGGAGTCTGCTGG - Intronic
1055560501 9:77517026-77517048 CTCTGCTAGTGAGAGAGTGGAGG + Intronic
1055613401 9:78045810-78045832 CTGTGCTCCTGGGACTGTGCAGG + Intergenic
1057491338 9:95522250-95522272 CTCTACCTGTGTGAGTTTGCTGG + Intergenic
1057910758 9:99018392-99018414 CTGTGCTCATGGGAGTGTGAGGG + Intronic
1058031912 9:100209420-100209442 CTTTGGGTGTGGGAGTGTTCTGG + Intronic
1059397940 9:114050375-114050397 CTGTGGTTGTGGGGGTGTGGGGG + Exonic
1060124590 9:121030665-121030687 CTCTGATTGTTGGAGTGGGAAGG - Intronic
1060758403 9:126228791-126228813 TTCTGCGTGTGGGTGTGTGTGGG - Intergenic
1061876306 9:133545861-133545883 TTCTGCGAGGGGGAGTGTGCTGG - Intronic
1062043976 9:134416728-134416750 CTCTGCTTCTGGGCCTTTGCAGG + Intronic
1186969397 X:14823891-14823913 CTCTCCTTATTGGAGTGTGTAGG - Intergenic
1189334896 X:40165107-40165129 CTCTGCTTGTTTGAGAGTGGGGG - Intronic
1190150625 X:47944458-47944480 CTCTGGTAGTGGGAGTGGGGTGG + Intronic
1190756226 X:53404325-53404347 CCCTGCTTGTGGTAGTGGGCGGG - Intronic
1193326733 X:80186767-80186789 CTGTTCTTGTGTTAGTGTGCTGG + Intergenic
1195860576 X:109378638-109378660 CACTGCTTGTGTGTGTATGCTGG + Intronic
1197034157 X:121854199-121854221 CTTTGCTGGTGCGTGTGTGCGGG + Intergenic
1197815559 X:130494452-130494474 CCCTGCTCATGGGAGTGTGGAGG + Intergenic
1199528186 X:148816141-148816163 CTTTGCTAGTGGGATTGGGCTGG + Intronic
1201500495 Y:14637264-14637286 CTCTGTTTGTGAGAGTGCTCAGG - Intronic
1201669981 Y:16508929-16508951 CTCTGCTTCTAAGAGTGTGGTGG + Intergenic
1202095683 Y:21246314-21246336 CTCAGCTTTTGGCAGTGTGAGGG + Intergenic