ID: 1106804202

View in Genome Browser
Species Human (GRCh38)
Location 13:33289553-33289575
Sequence ACTATTACACAGGAGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106804198_1106804202 18 Left 1106804198 13:33289512-33289534 CCTTTGTGCATCTCCAAGCTGAT 0: 1
1: 0
2: 4
3: 27
4: 198
Right 1106804202 13:33289553-33289575 ACTATTACACAGGAGAGACAGGG 0: 1
1: 0
2: 1
3: 22
4: 232
1106804199_1106804202 5 Left 1106804199 13:33289525-33289547 CCAAGCTGATGCTATTTTCACTC 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1106804202 13:33289553-33289575 ACTATTACACAGGAGAGACAGGG 0: 1
1: 0
2: 1
3: 22
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106804202 Original CRISPR ACTATTACACAGGAGAGACA GGG Intronic
902844325 1:19097729-19097751 ACTACTACCCAGGACAAACAAGG + Intronic
904352670 1:29919028-29919050 ACTAATACACAGGCCAAACATGG - Intergenic
906562569 1:46769860-46769882 ATTAATACACAAGAGAGACGAGG - Intronic
907173040 1:52489345-52489367 ACTGATATACATGAGAGACAGGG + Intronic
908435750 1:64104228-64104250 ACTAGTACATAGAAGAGTCAGGG + Intronic
909077579 1:71069892-71069914 AATATGACACAAGGGAGACATGG + Intronic
910580119 1:88815530-88815552 ACTAATAAACAGGACAGATATGG - Intronic
911429720 1:97769179-97769201 AGTATTCCACAGGAAAGAAAAGG + Intronic
911438342 1:97892376-97892398 ACTATGACTAATGAGAGACATGG - Intronic
912308774 1:108598059-108598081 GCTATTACACATGTGAGCCACGG - Intronic
912668169 1:111601704-111601726 AAGGTTACACAGGAGAGAAATGG - Intronic
913217773 1:116634909-116634931 GCTACCCCACAGGAGAGACAAGG + Intronic
914327794 1:146637264-146637286 ACTATTTTTCAGGAGATACAAGG + Intergenic
914907222 1:151756506-151756528 GCTATTACACAGTGGGGACAGGG + Intergenic
918600385 1:186351638-186351660 TCTATTATACAGGAAAGAGATGG + Intronic
919571582 1:199255558-199255580 ACTATTCCACAGGATAAAGAGGG - Intergenic
920776813 1:208946670-208946692 TCAATTACACAGAGGAGACAGGG + Intergenic
922138125 1:222852732-222852754 ATTATTCCCCAGGAGAGCCAAGG - Intergenic
924565703 1:245196441-245196463 ACCATTCAACAGGAGAGCCAGGG - Intronic
924906732 1:248462454-248462476 ACTATTCCACAAGATAGAGAGGG + Intergenic
1063055902 10:2503909-2503931 AACAGTACACAGGTGAGACATGG + Intergenic
1067179593 10:43974517-43974539 ACTATAAGACAGTAAAGACATGG + Intergenic
1068096246 10:52495019-52495041 ACTATAACACAGTAGAGGCAAGG - Intergenic
1072419328 10:95276467-95276489 ACCATAACACAGAAGTGACAAGG + Intronic
1072642861 10:97225892-97225914 AATATTAAAAAAGAGAGACAGGG + Exonic
1073817494 10:107223916-107223938 ACAATTACACATGTGAGACATGG - Intergenic
1075678207 10:124312433-124312455 ACTATCTCACAGGAGAGCCAAGG + Intergenic
1076034967 10:127191934-127191956 ACTACAACATATGAGAGACATGG - Intronic
1076430001 10:130395114-130395136 ACTGTTACAGAGGAAAGCCAGGG - Intergenic
1077999098 11:7478784-7478806 CCTGCTACACAGGAGAGCCAAGG + Intergenic
1080932877 11:36831113-36831135 ACTACTAGACAGGAGAGGGAAGG - Intergenic
1082202787 11:49393261-49393283 ACTAGTAAAAAGGAGAGACCAGG - Intergenic
1082768069 11:57184238-57184260 ATTAGTGCACAGGAGAGAGAGGG - Intronic
1083612081 11:64009143-64009165 CCTAATAAACAGGAGAGACACGG + Intronic
1084467272 11:69333143-69333165 AATAGTACAAAGGTGAGACATGG - Intronic
1085845336 11:80058742-80058764 AGTATTACACAGGAAAAACAAGG + Intergenic
1086916711 11:92538094-92538116 ACTATTAATAAAGAGAGACAGGG - Intronic
1088078805 11:105884284-105884306 GCAATTACATAGGAGATACAAGG + Intronic
1088584227 11:111346609-111346631 AAAAGTACACAGGTGAGACAAGG + Intergenic
1088745603 11:112801570-112801592 ACTATTACTGAGGAGTGAGACGG - Intergenic
1089120250 11:116129177-116129199 ACTAATACCCAGGCCAGACAGGG - Intergenic
1091816102 12:3439339-3439361 ACCGGTACCCAGGAGAGACAGGG - Intronic
1091942642 12:4502124-4502146 ACTAGTACATAGGATAGTCAAGG - Intronic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1093042510 12:14399969-14399991 ACTATGTCCCCGGAGAGACATGG - Intronic
1093604238 12:21070576-21070598 ACTATTCCACAGGATAGAGAAGG - Intronic
1093823004 12:23644668-23644690 CCTATGATACAGGAGAGAGAAGG + Intronic
1096447899 12:51710776-51710798 ACTAGAAAACAGGAGAGTCAGGG - Intronic
1097590812 12:61573060-61573082 ACTATAACACATAAGAGACCAGG - Intergenic
1098716338 12:73831553-73831575 ACTACTACACAACAGAGGCAAGG + Intergenic
1100158610 12:91831496-91831518 AATCCTACACAGGAGAGGCATGG + Intergenic
1101374292 12:104157411-104157433 ACTATTACACAGATGTGACCAGG - Intergenic
1101715679 12:107309850-107309872 AGAATTCCACAGGAGGGACATGG + Intergenic
1104241895 12:126998080-126998102 AGTATTAGACAGGAGAGCCCAGG - Intergenic
1106060338 13:26284721-26284743 ACTATTCCACAAGATAGAGAAGG + Intronic
1106804202 13:33289553-33289575 ACTATTACACAGGAGAGACAGGG + Intronic
1106812420 13:33372626-33372648 ACTATTCCACAGAAGGCACATGG + Intergenic
1106995279 13:35473567-35473589 ACTCTTCCAAAGGAGAGCCATGG + Intronic
1107676774 13:42805919-42805941 AGAATTACAAAGGAGAGAAAAGG + Intergenic
1107856594 13:44622135-44622157 ATTATGCCACAGGAGAGAAAGGG + Intergenic
1108593882 13:51934210-51934232 ACAAGCACACAGGAGAGAAAAGG + Exonic
1108862225 13:54875392-54875414 ACTATCACATAGGAAAGACCAGG - Intergenic
1111380811 13:87448690-87448712 ATTAATAGAAAGGAGAGACAGGG + Intergenic
1111759200 13:92440251-92440273 ACTACTACAATGGAGAGAGAGGG - Intronic
1112950653 13:104992008-104992030 TCTATTACTCATGAGAAACATGG + Intergenic
1116854796 14:49942585-49942607 TCTATTCCACAGGAGTGAAAGGG - Intergenic
1117266561 14:54093787-54093809 ACTAGTTCACTGGAGAGAAATGG + Intergenic
1117892211 14:60437572-60437594 AGTATTACTCAGGAGAGAATAGG + Intronic
1118506838 14:66422857-66422879 CTTATTACACAGAAGAGAGAGGG - Intergenic
1118526553 14:66651064-66651086 TCTAATACACAGGAGTGAGATGG + Intronic
1118687905 14:68310187-68310209 CCTTTTACACAGGAGAGAGGTGG - Intronic
1120185665 14:81391464-81391486 CCAATTACACAGGAGAGACTAGG - Intronic
1122302678 14:100739865-100739887 ACTGTTCCACAGAAGAGAAAAGG + Intergenic
1125376920 15:39039977-39039999 AATATTACACAGGAGGGAAATGG + Intergenic
1126096161 15:45092259-45092281 ACAATTACACAGATGAGAAAAGG - Intergenic
1126275262 15:46871387-46871409 ACTAGTACAAAGGAGAAACAAGG - Intergenic
1127621665 15:60740049-60740071 TCTATTAGAAAGGAGAGAAAGGG + Intronic
1129436346 15:75544192-75544214 AATATAACACAGAAGAGAAACGG + Intronic
1130358642 15:83159436-83159458 ACTATTCCAGAGGAGCTACAGGG + Intronic
1130627333 15:85529096-85529118 ACAATTACACTGCAAAGACATGG - Intronic
1134078767 16:11310459-11310481 AATATTACACAGCAGTGAGAAGG - Intronic
1134192524 16:12133204-12133226 ACTAGTAAGCAGGAGAGCCATGG - Intronic
1134336708 16:13306425-13306447 ACTATTTGATAGGAGAGAGAGGG + Intergenic
1134529703 16:14973926-14973948 AGTATAAAACAGGAGAGAAAAGG + Intergenic
1135226847 16:20668006-20668028 ACTATGAGAAGGGAGAGACAGGG + Intronic
1135789143 16:25377414-25377436 ACTATTACACAGGAGAGGCCGGG - Intergenic
1137672269 16:50285849-50285871 ACTAGCACACAGGAGATATAAGG + Intronic
1137688427 16:50402871-50402893 TATTTTTCACAGGAGAGACATGG - Intergenic
1139001771 16:62519564-62519586 ACTATTATAAAGGAGGCACATGG + Intergenic
1139866647 16:70067036-70067058 AGTATAAAACAGGAGAGAAAAGG - Intergenic
1140005765 16:71073673-71073695 ACTATTTTTCAGGAGATACAAGG - Intronic
1140064271 16:71597022-71597044 ACTATTCCACAAGATAGAGAAGG + Intergenic
1141241852 16:82272234-82272256 AATATTAAACTGGATAGACATGG + Intergenic
1148252609 17:46097610-46097632 AATATTACACTGGGGATACATGG + Intronic
1150700103 17:67439196-67439218 TCAATTACACAGGAGAGAAATGG - Intronic
1155473242 18:26212556-26212578 ACTATCACAAAGGAGAGCAAAGG - Intergenic
1155588606 18:27398570-27398592 ACAATCAGACAGGACAGACAGGG - Intergenic
1155847310 18:30724721-30724743 TCTCTTAGACAAGAGAGACAAGG - Intergenic
1156001941 18:32394866-32394888 ACTATTTCACAGGTGAAAGAAGG - Intronic
1158952703 18:62509913-62509935 TCTTTTACACAGGAGAGAATTGG - Intergenic
1159983764 18:74818177-74818199 ACTAACACACAAGGGAGACATGG - Intronic
1160486150 18:79294640-79294662 ACTATGACACACGAGACACCTGG + Intronic
1160532298 18:79572554-79572576 GCCAGGACACAGGAGAGACACGG + Intergenic
1160582423 18:79891914-79891936 ACAAGTACACAGGAGAGTCAAGG - Intronic
1160771361 19:832782-832804 AAAATTACACAGGAGAGGCCGGG + Intergenic
1162075721 19:8185885-8185907 AATATTAAACAGGAGTGAAAAGG - Intronic
1162895355 19:13762233-13762255 CCTAGTACACAGAAGAGACAGGG + Intronic
1163984526 19:20932748-20932770 ACTATTACAAATTATAGACAGGG + Intronic
1165037481 19:33044208-33044230 ACTAGGACTCAGGAGAGGCAGGG + Intronic
1165291166 19:34887471-34887493 ACTAGTACACATGTGACACAAGG + Intergenic
1165580689 19:36860757-36860779 AATATTACAGTGGAGAAACATGG - Intronic
1168273315 19:55262175-55262197 ACTGTTGCTCAGGAAAGACAGGG + Intergenic
925070516 2:963953-963975 ACTGTTAAAAATGAGAGACACGG - Intronic
926615232 2:14990918-14990940 ACAACTACAGAGGAGAGACATGG + Intergenic
926677011 2:15633437-15633459 ACTTTAACACATGATAGACATGG + Intergenic
927286231 2:21359924-21359946 ACTACTACATACTAGAGACAAGG - Intergenic
928236188 2:29543318-29543340 ACATTTAAACAGGAGAGACTAGG + Intronic
928276867 2:29909316-29909338 ACTCTGACACAGGAAAGAGAAGG + Intronic
928278791 2:29925778-29925800 ACTTTTAAACAGGAGAGATAAGG - Intergenic
929737658 2:44567485-44567507 TCTATTACAAAGGATTGACATGG - Intronic
929774282 2:44918566-44918588 ACTATTATAAAGGTGAGTCATGG - Intergenic
931425019 2:62162826-62162848 AGTAGTAGACAAGAGAGACAAGG + Intergenic
931848445 2:66228959-66228981 TCTAGTACACAGAAGAGAAAAGG - Intergenic
933841832 2:86293031-86293053 CCTCTTACACAGGAGGGACCTGG + Intronic
935320938 2:101888603-101888625 ACTACTTCACAGGATAGGCAAGG + Intronic
935626698 2:105177619-105177641 ACTCTGACACAGGTGAGAGAGGG + Intergenic
935856970 2:107285315-107285337 ACTTTTACAGAGGAAAGAGAGGG + Intergenic
936243202 2:110805871-110805893 ACCAATACACGGGAGAGGCAGGG - Intronic
937070312 2:119058099-119058121 TGTATTACACAGGACAGACATGG - Intergenic
938124457 2:128661948-128661970 ACTATAAAATAGGAGAGAGAGGG - Intergenic
939858302 2:147387672-147387694 ACTAGTAAACAGGCAAGACACGG - Intergenic
940034411 2:149298583-149298605 ACTATTCCACAGGATAAAGAAGG - Intergenic
940618393 2:156080651-156080673 ACTATTCCACAAGATAGAGAAGG - Intergenic
940866073 2:158818993-158819015 CCTATCACACAGGAGAAACCTGG - Intronic
941704142 2:168639987-168640009 ACTATTCCAAAGCACAGACAAGG + Intronic
942512540 2:176717714-176717736 ACTACTACAGAGAGGAGACATGG + Intergenic
946451699 2:219785416-219785438 ACTCTTACAGAGGAAAGACCAGG + Intergenic
946501588 2:220253341-220253363 ACTATTCCACAAGATAGATAAGG + Intergenic
948219589 2:236259157-236259179 AATATTAAACAGTAGAGACTTGG + Intronic
948568838 2:238904635-238904657 ACTAGAACACAGGGAAGACACGG - Intronic
948744836 2:240081429-240081451 AATATTACCCAGGATAGAGAGGG + Intergenic
1169954883 20:11090405-11090427 ACTATTACACTGAAAAGAAATGG - Intergenic
1170077140 20:12432255-12432277 ACCAGTACACAGAAGAAACAAGG - Intergenic
1172766779 20:37355318-37355340 ACTAGGGCACAGGAGAGAAACGG - Intronic
1174227172 20:49010500-49010522 ACTATATCACAGTAGAGCCAAGG - Intronic
1174752288 20:53123487-53123509 ACAATTACACAGGTGTGATATGG - Intronic
1174940880 20:54925523-54925545 ACAAATACACAGGAGAGAAGAGG - Intergenic
1177101882 21:16908200-16908222 ACTATTACATAATAGAGGCAAGG - Intergenic
1177329119 21:19633223-19633245 ACTATTCCACAAGATAGAGATGG + Intergenic
1179607618 21:42527402-42527424 ACCACTACACACGAGAGTCAGGG - Intronic
1181688838 22:24546967-24546989 ACTTTGACACAGAAGAGACCCGG - Exonic
1182836658 22:33347645-33347667 ATTATGACACATGAGAGAAAAGG + Intronic
1183916485 22:41124622-41124644 ACTATTAAAAAATAGAGACAGGG - Intronic
1184033106 22:41906231-41906253 TTTATTACACAGGACAGCCAGGG + Exonic
950359869 3:12442584-12442606 ACTATTACCCAGGAGACGCTGGG - Intergenic
951370477 3:21840218-21840240 AGTATTACACATGCAAGACATGG + Intronic
952016807 3:28966772-28966794 AATTTTACACAGGAGATAAAAGG - Intergenic
953664263 3:44914838-44914860 TCTAATTCACAGGAGAGTCATGG + Exonic
955827877 3:62967367-62967389 ACTCTTACATGGGAGAGACATGG + Intergenic
956724722 3:72147524-72147546 GCTAATACAAAGGACAGACAAGG - Intergenic
963504440 3:146165772-146165794 AGTATTACAGAAGAGAGACTGGG + Intergenic
964141766 3:153410557-153410579 ACAAATACACAGAAGAGAGAAGG + Intergenic
964160940 3:153644233-153644255 ACTATTCCACAAGACAGAGAAGG + Intergenic
964270922 3:154955938-154955960 ACTATTATACAGGAGTGAATTGG + Intergenic
964707765 3:159638391-159638413 ATTATGACTCAGGTGAGACAAGG - Intronic
965764728 3:172118497-172118519 ACGATTACCCAGGAGAAAGAAGG + Intronic
966980780 3:185133450-185133472 CCTATTACACAGGCCAGGCATGG + Intronic
969427880 4:7136471-7136493 AGTGCTACACAGGAGAGGCAGGG - Intergenic
969619884 4:8273606-8273628 ACTCTAACTCAGGAGAGACCCGG - Intronic
975716840 4:77213374-77213396 ACCAATACACAGGACACACAGGG + Intronic
976791526 4:88884111-88884133 ACTATTCCACAAGATAGAGAAGG + Intronic
977250366 4:94682310-94682332 ACTCCAAAACAGGAGAGACAGGG + Intergenic
977984174 4:103362083-103362105 ACAAGTACACAGGAGAGCAAGGG - Intergenic
978958434 4:114644103-114644125 ACTATTTCTCAAGAGAGAAATGG - Intronic
978959222 4:114655472-114655494 ACAATTCCACATGAGAAACATGG - Intronic
979628689 4:122876075-122876097 CCTGTGACACAGGAGCGACAAGG + Intronic
980922590 4:139102151-139102173 ACTATTACACATCAGAAAAAAGG + Intronic
983259596 4:165441360-165441382 ACTATGTCACAGGAAAGCCAAGG - Intronic
986968441 5:13303472-13303494 AATAGCACAGAGGAGAGACAGGG - Intergenic
987563814 5:19558750-19558772 ACTATTCCACAAGACAGAGAAGG + Intronic
987703131 5:21427307-21427329 ACTCATACAGAGGAGAGACAAGG - Intergenic
988625418 5:32869782-32869804 AATATTAGATAGGAGAGGCAGGG + Intergenic
991205550 5:64046232-64046254 ACTATTCCAAAGGCCAGACATGG + Intergenic
991293110 5:65051932-65051954 AATATTACACAGCAGAAAAAAGG - Intergenic
991326525 5:65439340-65439362 AAAATTACAAAGGAGAAACATGG + Intronic
993882290 5:93377438-93377460 ACTACTAGACAGGGGAGAGATGG + Intergenic
994865477 5:105263630-105263652 ACTATTATACAAGAGATAAAGGG - Intergenic
995672287 5:114619652-114619674 ACTAATAATCAGGAGAGACTAGG + Intergenic
995699701 5:114920801-114920823 ACTATTCCACAAGATAAACAGGG + Intergenic
1000492927 5:161937763-161937785 ACTACTAGACAGGAGAGGTAGGG - Intergenic
1006314612 6:33282919-33282941 ACAATTACAAAGGCCAGACACGG + Intronic
1008239231 6:49088333-49088355 TCTATTATACCGTAGAGACAGGG + Intergenic
1011179679 6:84606087-84606109 AGAATTACACATGAGAGACTTGG + Intergenic
1013396668 6:109747698-109747720 TGTATGACACAGGAGAGAAAAGG + Intronic
1014152755 6:118077407-118077429 ACTACTCTACAAGAGAGACAGGG + Intronic
1014602856 6:123436773-123436795 ACTATTACACAGGAAAGATCTGG + Intronic
1015305225 6:131699733-131699755 ACCATTGAACAGTAGAGACAGGG + Intronic
1018535633 6:164816055-164816077 ACTATCACACAGCAAAGAGAAGG - Intergenic
1018755556 6:166846312-166846334 ACTATTCCACAGGATAGAGAAGG + Intronic
1021616205 7:22505630-22505652 ACTCTTACCCAGGAGGGAAAAGG + Intronic
1022811995 7:33878752-33878774 ACTAATACACAAGAGCTACAGGG + Intergenic
1022925995 7:35056845-35056867 ACTCTTACCCAGGAGGGAAAAGG + Intergenic
1024275685 7:47675094-47675116 ATTGTAACACAGGAGAGAAACGG + Intergenic
1024395721 7:48864545-48864567 AATATTACACAGCAATGACAAGG - Intergenic
1024399512 7:48907731-48907753 AATATTACACAGCAATGACAAGG + Intergenic
1025984754 7:66439977-66439999 ACATTTACACAAGAGAGATAAGG + Intergenic
1027541175 7:79468060-79468082 ACTAATACATAGTAGAGATAAGG + Intergenic
1027541178 7:79468111-79468133 ACTAATACATAGTAGAGATAAGG + Intergenic
1028525806 7:91785240-91785262 ACTCTTACACAGAAGAAACCTGG + Intronic
1028565912 7:92230739-92230761 CCTATGATACAGGAGAGAGATGG + Intronic
1028993124 7:97071697-97071719 ACTATTCCACAAGATAGAGAAGG - Intergenic
1029824006 7:103171534-103171556 ACTCTTACCCAGGAGGGAAAAGG + Intergenic
1033739336 7:144257960-144257982 ACCATTGAACAGTAGAGACAGGG + Intergenic
1034393817 7:150804869-150804891 ACTAATAATCAGGAGAGGCATGG - Exonic
1035014349 7:155751746-155751768 AACATTACAGAGGAGAGACTTGG - Intronic
1035545520 8:479447-479469 AATGTTACATAGGAGAGCCAGGG - Intergenic
1037838046 8:22225946-22225968 TCTGTCACACAGAAGAGACACGG - Intronic
1039360482 8:36871617-36871639 ACTATAATAAAGGAGAGACAAGG + Intronic
1040809606 8:51437290-51437312 ACTATTCCACAAGACAGAGACGG + Intronic
1041293371 8:56329740-56329762 ACTATTCCACAAGACAGAGAAGG - Intergenic
1042635623 8:70870203-70870225 ACTCTTTCAAAGGAAAGACATGG - Intergenic
1043925088 8:86027706-86027728 ACTATTAGATGGGGGAGACAGGG - Intronic
1044368907 8:91385057-91385079 AATATTCCACAGGAGAGAGCTGG + Intronic
1045107594 8:98907996-98908018 ACTATTTCCCAGGAGATAAAGGG - Intronic
1046378471 8:113419722-113419744 ACTATTATAAAGGAGATAAAAGG - Intronic
1047133049 8:122043688-122043710 ATTATCACACAGGAGAAAGAGGG - Intergenic
1047249637 8:123171990-123172012 ACAATTTCACCAGAGAGACAAGG + Intergenic
1049346516 8:142142139-142142161 AACATAACACATGAGAGACAAGG - Intergenic
1051325887 9:15967851-15967873 AATGTTACACAGGAGACAAATGG + Intronic
1051509539 9:17862134-17862156 ACAAATCCTCAGGAGAGACAGGG - Intergenic
1051533998 9:18136551-18136573 GCTATGGCACAGGAGAGAAAAGG + Intergenic
1051624696 9:19087919-19087941 AGAATTAAACAGGACAGACAAGG - Intronic
1053027711 9:34744149-34744171 ACAATTGCTCAGGAGAAACAGGG - Intergenic
1053159155 9:35801519-35801541 ACTGTTACACCTGAGAGACAGGG - Intronic
1055695719 9:78882183-78882205 ACATTTACACAAAAGAGACAGGG - Intergenic
1056322435 9:85448925-85448947 ACTATTCCACAAGATAGAGAAGG - Intergenic
1057810989 9:98256305-98256327 ACTATGACCCAGGAGTGGCATGG - Intergenic
1058188386 9:101883470-101883492 ACAATTAGACAGGAGATACAGGG - Intergenic
1058769758 9:108219074-108219096 ACTACTACATAGCAAAGACATGG + Intergenic
1058800831 9:108543142-108543164 ACAAGTACACCCGAGAGACAAGG - Intergenic
1061568342 9:131459368-131459390 ACAAATACACAGGACAGCCAAGG - Intronic
1186277925 X:7960023-7960045 AATATTATACAGCAGAGCCAGGG - Intergenic
1186579565 X:10803017-10803039 ACTATTATAGGGGAGAGAGAGGG + Intronic
1191615427 X:63165021-63165043 ACTATCACACAAAAGAGAAAAGG + Intergenic
1191620871 X:63213902-63213924 ACTATCACACAAAAGAGAAAAGG - Intergenic
1191867106 X:65712940-65712962 GCTATTAAGCAGGGGAGACAGGG - Intronic
1191963066 X:66725072-66725094 ACTATTAAATAGTAAAGACATGG + Intergenic
1192131011 X:68550031-68550053 ACTATTAGAGAGGAGAGGTAGGG + Intergenic
1192671788 X:73152091-73152113 ACTATTCCACAAGAGAAAGAGGG - Intergenic
1192951142 X:76017924-76017946 ACTATTTCACAAGATAGATAAGG + Intergenic
1193324453 X:80163239-80163261 ACTATTATACAGAATATACAAGG + Intergenic
1193665729 X:84313927-84313949 ACTATTACACAAAAGAGAGGAGG + Intergenic
1195547584 X:106130103-106130125 ACTACTTCATAGGGGAGACATGG - Intergenic
1195838567 X:109147218-109147240 ACTATTCCACAGGATTGAGAAGG + Intergenic
1196622311 X:117837802-117837824 ACTATTCCAGAGGTGAGACTTGG + Intergenic
1200462572 Y:3475556-3475578 ACTACTATACAGGGGAGATAGGG - Intergenic