ID: 1106804235

View in Genome Browser
Species Human (GRCh38)
Location 13:33289792-33289814
Sequence TAGAAGCCACAAGCCCTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106804234_1106804235 -9 Left 1106804234 13:33289778-33289800 CCTTAGTCAATCAATAGAAGCCA 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1106804235 13:33289792-33289814 TAGAAGCCACAAGCCCTCTTAGG 0: 1
1: 0
2: 2
3: 11
4: 148
1106804232_1106804235 -2 Left 1106804232 13:33289771-33289793 CCAGAGCCCTTAGTCAATCAATA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1106804235 13:33289792-33289814 TAGAAGCCACAAGCCCTCTTAGG 0: 1
1: 0
2: 2
3: 11
4: 148
1106804233_1106804235 -8 Left 1106804233 13:33289777-33289799 CCCTTAGTCAATCAATAGAAGCC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1106804235 13:33289792-33289814 TAGAAGCCACAAGCCCTCTTAGG 0: 1
1: 0
2: 2
3: 11
4: 148
1106804231_1106804235 -1 Left 1106804231 13:33289770-33289792 CCCAGAGCCCTTAGTCAATCAAT 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1106804235 13:33289792-33289814 TAGAAGCCACAAGCCCTCTTAGG 0: 1
1: 0
2: 2
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106804235 Original CRISPR TAGAAGCCACAAGCCCTCTT AGG Intronic
900688446 1:3964722-3964744 CAGAAGCCACCAGCCTTCTGCGG - Intergenic
901509606 1:9710237-9710259 TAGGAGCCACAAGCCACCCTGGG + Intronic
904763540 1:32822883-32822905 AAGAGACCAAAAGCCCTCTTTGG + Intronic
906500752 1:46340547-46340569 AAGAAGCCCCTAGCCCACTTGGG - Exonic
908031880 1:60009292-60009314 TAGCAGCCACAGGCCTCCTTTGG - Intronic
910444805 1:87289247-87289269 TAGAAGCCACTAGCTCTATGTGG - Intergenic
910482345 1:87672530-87672552 TGGAAGCCTAAAGCCATCTTGGG - Intergenic
911452234 1:98077992-98078014 TAGAAGCTACAAGGCCTCTAAGG + Intergenic
911924578 1:103813116-103813138 TAGTAGCCACAAGCCACCTGTGG - Intergenic
912238022 1:107873796-107873818 TAGAAGGCACCAGCCTTCTCAGG - Intronic
912523969 1:110267010-110267032 TGGAAGCTACAAGACCTCTGGGG - Intronic
913138799 1:115919368-115919390 TAGAATTCAGATGCCCTCTTAGG + Intergenic
913609305 1:120494612-120494634 TAGAAGCCAGAAGATCTCTATGG - Intergenic
913986151 1:143568065-143568087 TAGAAGCCAGAAGATCTCTATGG + Intergenic
914204520 1:145515838-145515860 TAGAAGCCAGAAGATCTCTGTGG + Intergenic
914371031 1:147024390-147024412 TAGAAGCCAGAAGATCTCTATGG - Intergenic
914483645 1:148089026-148089048 TAGAAGCCAGAAGATCTCTATGG + Intergenic
914581887 1:149027227-149027249 TAGAAGCCAGAAGATCTCTATGG + Intronic
915779056 1:158525288-158525310 TGGAAGTTCCAAGCCCTCTTTGG - Intergenic
922058715 1:222066704-222066726 TAAAAGCCACATGCCATTTTTGG + Intergenic
922216575 1:223524921-223524943 GAGAAGCCAAGAGCCCTCCTGGG - Intergenic
1064963914 10:20996122-20996144 TAGAAGTCTCCAGCCTTCTTTGG - Intronic
1065519621 10:26558978-26559000 TGGAAGCCACTGGCCCACTTGGG + Intronic
1072010207 10:91296597-91296619 GAGAAGCCACAAGCCCTAGCTGG - Intergenic
1077837912 11:5940411-5940433 TAGAAGCTACAAGGCCTCTTAGG + Intergenic
1078555638 11:12323767-12323789 CAGAAGCCACAAGCCCCATGTGG - Intronic
1079476647 11:20837541-20837563 TAGAAGGAACAAGCCTTCCTTGG + Intronic
1079479625 11:20865670-20865692 TGAAAGCCACAGGCCCTATTAGG + Intronic
1079823072 11:25156253-25156275 TAGAACCCTCATGCCCTGTTGGG - Intergenic
1081976003 11:47235220-47235242 AAGGAACCACAAGCCCTCTGTGG - Intronic
1083540016 11:63506076-63506098 TGGAAACCACAAACCCTCGTTGG + Intronic
1087015814 11:93553808-93553830 AAAAAGTCACTAGCCCTCTTAGG + Intergenic
1089736882 11:120555771-120555793 AAGAAGCCCCAAGGCCTCTGAGG - Intronic
1091160187 11:133412945-133412967 AAGAATCCACAAGTCTTCTTTGG + Intronic
1094246923 12:28308838-28308860 TGGAAGCCAGAAGACCACTTAGG - Intronic
1095559380 12:43547615-43547637 TAAAGGCCTCAAGCCCTCTATGG - Intronic
1097921033 12:65073971-65073993 TAAAAACAACAAGCCTTCTTTGG - Intronic
1098030608 12:66249651-66249673 TAGAGGCCACCTGCCTTCTTTGG + Exonic
1100123810 12:91398968-91398990 TAAAAGCCAGAAGGCATCTTGGG - Intergenic
1100516250 12:95330785-95330807 CAGAAGCCCCAAGCTATCTTGGG + Intergenic
1101532624 12:105587791-105587813 TAGAAGCCACTAGCTCTGTGTGG + Intergenic
1104037275 12:125106276-125106298 CAGAAGCCACAAGCCATCTTGGG - Intronic
1104642491 12:130476379-130476401 TAGAAGTCACCAGTCGTCTTTGG - Intronic
1105610611 13:21966303-21966325 TGGAAGCCACATGCCATCTTTGG - Intergenic
1106427017 13:29641004-29641026 GAGAAGCCTCAAGGCCTCTCTGG - Intergenic
1106804235 13:33289792-33289814 TAGAAGCCACAAGCCCTCTTAGG + Intronic
1112671740 13:101647737-101647759 TTAAAGCCACCAGCCCTTTTGGG + Intronic
1114966799 14:27971657-27971679 TAGGAGGCACAATCCCTCCTGGG + Intergenic
1117484909 14:56186206-56186228 TAGAAGCCACCTGCACTCCTTGG - Intronic
1118743858 14:68760153-68760175 TAGAACCCACAAGGGCTCTCAGG + Intergenic
1120691746 14:87600529-87600551 CAGCAGTCACATGCCCTCTTGGG - Intergenic
1121114948 14:91336938-91336960 TACCAGCCAGAAGGCCTCTTAGG - Intronic
1121438975 14:93936933-93936955 AGGAAGCCAGAATCCCTCTTAGG - Intronic
1125214344 15:37253004-37253026 TAGAAGCCACAAGCACGAGTTGG - Intergenic
1129829644 15:78660387-78660409 GAGAAGCCAAAAACCCTCCTGGG + Intronic
1132772411 16:1571307-1571329 TAGAAGCCAGAAGACTCCTTAGG - Intronic
1135726457 16:24857565-24857587 TAGAAGCCACCTGCACTCCTTGG + Intronic
1137037710 16:35580360-35580382 GAGAAGCTAAAAGTCCTCTTTGG + Intergenic
1137809915 16:51343125-51343147 CAGATGTCACAAGCCATCTTGGG - Intergenic
1139042225 16:63011637-63011659 AAGAAGCCATAAGCCCTATACGG + Intergenic
1139694823 16:68666472-68666494 CAGGAGCCCCAAGGCCTCTTGGG + Intronic
1140987013 16:80167721-80167743 TGGAAACCACAAGCCCTCCAAGG + Intergenic
1141737066 16:85860900-85860922 TAGACGCCACCAGGCCTCCTTGG + Intergenic
1143495346 17:7309080-7309102 AGGAAACCACAAGGCCTCTTTGG - Intronic
1143674424 17:8421484-8421506 TAGAGGCCACCAGCGCTCCTTGG - Intronic
1151182128 17:72336894-72336916 TCCAAGCCACAAGCTCTCTGTGG - Intergenic
1151709268 17:75792044-75792066 TAGAAGCCATGAGCACGCTTAGG + Intronic
1152093068 17:78257600-78257622 GAGAAGCCCAAAGCCCTCTGTGG + Intergenic
1152229666 17:79108156-79108178 CAGAAGCCACATGGCCTCTGAGG - Intronic
1153662684 18:7339466-7339488 TGGAAGTCACAAGGACTCTTTGG - Intergenic
1154980746 18:21500368-21500390 TAGAAGCCAGAAAACCTCTTGGG + Intronic
1155045635 18:22100695-22100717 TAGAAGCCAGGAGCCCAGTTAGG + Intergenic
1155341490 18:24818590-24818612 CAGAAGCCACGGGCCCTCCTGGG + Intergenic
1155348464 18:24882409-24882431 TAGAGGCCATAGGCCATCTTGGG - Intergenic
1155447262 18:25925124-25925146 TAGAATCCACAAGGCCTATTAGG + Intergenic
1156361724 18:36389760-36389782 TAGAAGACACATGTCCTCCTGGG - Intronic
1156780278 18:40842648-40842670 GAGAAGTCACAAGCCCTCCCAGG - Intergenic
1159891950 18:73961352-73961374 TAGAAGCCACCCACCCTTTTAGG - Intergenic
1163357419 19:16823170-16823192 TAGAAGCCACACTCCCTGTGGGG + Intergenic
1163589565 19:18184640-18184662 AAGAAGCCAAGAGCCCTCCTGGG - Intergenic
1164470593 19:28527771-28527793 CAGAAGCCACAAGTTATCTTGGG + Intergenic
1168383387 19:55943024-55943046 TAGAAGCCACATGCCATCCTTGG - Intergenic
926115773 2:10212344-10212366 GTGAAGCCACAAACCCTCCTGGG + Intergenic
926755931 2:16235852-16235874 TAGAAGCTACCAGCAGTCTTGGG + Intergenic
928114212 2:28535383-28535405 TAGGAGCCACAGGGCCTCTGGGG - Intronic
928908308 2:36391689-36391711 TAGAAGCCTGAAGCCCTTTTTGG + Intronic
935078922 2:99772869-99772891 AAGCAGCCACAAACCCTCTCAGG - Intronic
939557728 2:143696697-143696719 TTGAATAAACAAGCCCTCTTAGG - Intronic
939804994 2:146764353-146764375 TGAAAGCCACAAACCCTCTTTGG - Intergenic
942097285 2:172546020-172546042 TAGGAGCCCCAAGTCATCTTGGG + Intergenic
943291072 2:186072450-186072472 TGGAAGCCAAAAGTCCTCTATGG + Intergenic
944734622 2:202550866-202550888 TAGAACCCAAAAGCCTACTTAGG - Intronic
948916882 2:241038960-241038982 GCCAAGCCTCAAGCCCTCTTAGG - Intronic
1171021608 20:21589089-21589111 TAGATGCCAGAAGCCCTCCTGGG + Intergenic
1171191491 20:23162592-23162614 TGGAAGCCAGGAGCGCTCTTAGG - Intergenic
1172812827 20:37662009-37662031 TAGAGGCCACCTGCCCTCCTCGG + Intergenic
1173261961 20:41444381-41444403 TGGAAGCCACTAGCCCTGTGTGG - Intronic
1177502053 21:21969373-21969395 TGGAAGCCAGAAGGCCTCTGTGG - Intergenic
1181726400 22:24813982-24814004 TAGGAGCCACAAGCATTGTTGGG - Intronic
1181910098 22:26231781-26231803 CAGAAGCCCCCAGCCCTCTGTGG + Intronic
1183474793 22:38030244-38030266 GAGAACCCACAAGCCCCCTGGGG + Intronic
1183688155 22:39373954-39373976 AAGGAGCCACAGGCCCTCCTGGG - Intronic
949114045 3:298032-298054 TAGAAGAAACAAGTCCACTTTGG - Intronic
950538046 3:13593024-13593046 CAGAAGCCACAAGGCCCCTTTGG + Intronic
951081252 3:18452681-18452703 TAGAAGCCATAATTCTTCTTTGG - Intergenic
953840403 3:46385656-46385678 TAGAAGCCCCAAACCCTACTGGG + Intergenic
954647583 3:52140886-52140908 TAGAAGGCTCATGCCCTCATGGG - Intronic
955873078 3:63460462-63460484 TTGAAGCCAGAAAGCCTCTTTGG + Intronic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
958045844 3:88282670-88282692 TAGATGCCACAAGCCTAATTTGG - Intergenic
959023763 3:101217110-101217132 TAGAACTCACAAGCCCACTCAGG - Intergenic
962198894 3:133385406-133385428 TAGAAGCCCACGGCCCTCTTGGG - Intronic
964538677 3:157755366-157755388 TAAAAGACACAATCCCTGTTAGG - Intergenic
978859641 4:113432788-113432810 TAGAAGCCACCTGCACTCCTTGG - Intergenic
981292107 4:143088349-143088371 GAGAAGACAAAAGCCCTCCTTGG - Intergenic
981882033 4:149625762-149625784 TAGAAGCAGGAAGCCCTCTCTGG - Intergenic
983015916 4:162611944-162611966 TAGAGGCCAGAACACCTCTTTGG + Intergenic
983367780 4:166816809-166816831 TAGAAGACAGAAGGCCTCTGTGG + Intronic
983694861 4:170515613-170515635 TAGGAGCCACAAGTTATCTTGGG - Intergenic
985517295 5:353669-353691 CAGAAGCCACAGGCCCCCTGGGG - Intronic
986395575 5:7326199-7326221 GAGAAGCCTCACGCACTCTTGGG + Intergenic
988374379 5:30415408-30415430 TAAAAGTAACAAGCGCTCTTTGG + Intergenic
993703100 5:91141833-91141855 CAAAAGCAACAAGCCCTCTAAGG + Intronic
995477632 5:112563814-112563836 GAGAAGCCACAGGCCCTCAATGG + Intergenic
997642645 5:135459385-135459407 TATTAGCCCCGAGCCCTCTTGGG + Intergenic
999818370 5:155200281-155200303 GAGGAGCCACAAACCCTCTGAGG + Intergenic
1003994547 6:11525871-11525893 CAGAAGCAAGCAGCCCTCTTTGG + Intergenic
1005431477 6:25762424-25762446 TAGAAGCAAAAAGCCCATTTTGG - Intronic
1005651361 6:27888201-27888223 TAGAAGCCCCAATCACTCCTGGG - Intergenic
1007379470 6:41478302-41478324 TAGAAGCCACTACCGCTCCTAGG - Intergenic
1011154413 6:84314070-84314092 TAGAAGCAAGAAGCCCAATTAGG + Intergenic
1012460777 6:99457730-99457752 TTAAAACAACAAGCCCTCTTAGG - Intronic
1013894802 6:115073815-115073837 CAGAAGCTACAACACCTCTTGGG + Intergenic
1016427739 6:143952496-143952518 CAGATGGCACAAGCCTTCTTTGG - Intronic
1021094570 7:16521098-16521120 GACAAGCCACAAGCCCTCTCTGG + Intronic
1021650451 7:22828014-22828036 GTGAAGCCAAAAACCCTCTTGGG + Intergenic
1021723878 7:23531629-23531651 TGGAACCCAGAAGCCATCTTGGG + Intronic
1028274365 7:88834927-88834949 TGAAAGGCACCAGCCCTCTTTGG + Intronic
1031787522 7:126052706-126052728 TAGAAGCCACACTGCCCCTTGGG + Intergenic
1040853632 8:51926728-51926750 TAGAAGCCTCAAACCCCATTGGG + Intergenic
1043422385 8:80111741-80111763 TAGAAGGAACAAGTACTCTTGGG + Intronic
1044079163 8:87862794-87862816 TAAAAGCCAGAGGACCTCTTCGG + Intergenic
1047906911 8:129482213-129482235 CAGAAGCCAGAAGCCACCTTAGG - Intergenic
1048161365 8:132024797-132024819 TAGAAGCCATGAGACCTCTGAGG + Intronic
1048729782 8:137425558-137425580 TGGAAGCCACAAGGTCTTTTGGG - Intergenic
1049501992 8:142971818-142971840 TGGAAGCCACTTGCCCTCCTAGG - Intergenic
1049734863 8:144199541-144199563 TAGCAGCCACAGGCCCCCTGGGG - Intronic
1050277019 9:4010533-4010555 AAGAAGCCACAATTCCTCTCTGG + Intronic
1050656147 9:7830904-7830926 TAGAGGCCACATGCACTCTTTGG - Intronic
1053447964 9:38167494-38167516 CAGCAGTCACAAGCCCTGTTTGG - Intergenic
1058992643 9:110269439-110269461 TGGAAGCTACAAGCTTTCTTGGG + Intergenic
1059523344 9:114964848-114964870 AAGAAGCCACTATCACTCTTAGG + Intergenic
1059618603 9:115978171-115978193 TAGAAGTTGCAAGCCCACTTTGG + Intergenic
1060399316 9:123338921-123338943 TGGAAGCCTCAAGCGCTCTCTGG + Intergenic
1187612611 X:20959016-20959038 TAGAAGCAAGAAGACCTGTTAGG - Intergenic
1192336659 X:70227083-70227105 TAGAAGGAACACGCCCTCTCTGG + Intergenic
1196058710 X:111384934-111384956 GAGAAACCACAACCTCTCTTTGG - Intronic
1196870242 X:120106573-120106595 CAGAAGCCCCAGGCCCTGTTGGG - Intergenic
1197126162 X:122948701-122948723 TAGAGGCCTCAGGCCCTCTCTGG + Intergenic
1198256642 X:134929870-134929892 TAGAAGCCCCAAAGCCTATTGGG - Intergenic
1199321349 X:146442750-146442772 CAGGAGCCCCAAGCCTTCTTGGG - Intergenic
1201541705 Y:15111933-15111955 TAAAACCCACAAGCCCTGTAGGG - Intergenic