ID: 1106806954

View in Genome Browser
Species Human (GRCh38)
Location 13:33319233-33319255
Sequence GATGCATGTTACAATATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 5, 2: 17, 3: 103, 4: 346}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106806951_1106806954 22 Left 1106806951 13:33319188-33319210 CCATACAATGGAATATTATTCAG 0: 293
1: 1204
2: 2225
3: 3196
4: 3921
Right 1106806954 13:33319233-33319255 GATGCATGTTACAATATGGATGG 0: 1
1: 5
2: 17
3: 103
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106806954 Original CRISPR GATGCATGTTACAATATGGA TGG Intronic
901073850 1:6539798-6539820 GATACATGCTACAACATGGATGG + Intronic
902046186 1:13526402-13526424 AGTGCATGTCACAACATGGATGG + Intergenic
902765200 1:18609780-18609802 CATACATGCTACAACATGGAAGG + Intergenic
903561560 1:24231878-24231900 GAAGCATGTCACAATATGGATGG + Intergenic
903784513 1:25849550-25849572 GATACATGCTACAACATGGATGG - Intronic
904818758 1:33226535-33226557 GATTCCTGCTACAATATGGATGG + Intergenic
905767905 1:40618217-40618239 GATACATGCTACAACATGGATGG - Intergenic
909852829 1:80489987-80490009 GAGGCATGTACAAATATGGATGG - Intergenic
911191606 1:94954245-94954267 GATGCTGTTTACAATATGTAGGG - Intergenic
913720958 1:121594170-121594192 GATACATGCAACAATTTGGATGG + Intergenic
915672779 1:157504282-157504304 GATGCATCCTACAAACTGGAAGG + Intergenic
916298910 1:163251823-163251845 GATACATGTAGCAACATGGATGG - Intronic
916473281 1:165144297-165144319 GATAAATGCTACAGTATGGATGG + Intergenic
916522488 1:165577379-165577401 GATACATGATACAACATGAATGG + Intergenic
916860402 1:168797896-168797918 GATGCATGCAACAACTTGGATGG - Intergenic
917305046 1:173616177-173616199 GATACATGTTACCACATGGATGG + Intronic
917783644 1:178428082-178428104 GATACATGTAACAATTTGGATGG - Intronic
918341529 1:183571901-183571923 GATTCATGATACAACATGGATGG - Intronic
919155579 1:193761494-193761516 GATACATGTAACAACATGGATGG + Intergenic
920262850 1:204701335-204701357 CATGGATGTTACAATATGCATGG + Intergenic
921371729 1:214430507-214430529 AATGCTTGTCACAATATGAATGG + Intronic
921952945 1:220951270-220951292 GATGGATCTTATAATATGTAAGG + Intergenic
922311016 1:224391030-224391052 GATGCATGCTACAGTATGAATGG - Intronic
923098040 1:230791028-230791050 GATACATGCTACAGCATGGATGG - Intronic
923487093 1:234443791-234443813 GATACATGCTACAACATGGATGG + Intronic
923767928 1:236910171-236910193 GACACATGCTACAATACGGATGG - Intergenic
923776880 1:236986695-236986717 GAAGGATGTTACAATACTGATGG - Intergenic
924407608 1:243767251-243767273 GATGAATGTTTCAATGAGGAGGG + Intronic
924599505 1:245476093-245476115 GATGCATGCTGCCATGTGGATGG + Intronic
924599739 1:245478138-245478160 AATGTTTGTTACAACATGGATGG - Intronic
1063276919 10:4579389-4579411 GAATCATGCAACAATATGGATGG + Intergenic
1063992944 10:11585808-11585830 GACCCATGCTACAATATGGATGG + Intronic
1064206910 10:13332209-13332231 GATTCATGCTACAACACGGATGG + Intronic
1064873015 10:19961265-19961287 GATGCATGTTGATATATGCAGGG - Intronic
1064896759 10:20245908-20245930 TATGCATGATACAATATGATGGG + Intronic
1065354765 10:24829119-24829141 GATACATGTTAAAACATAGATGG - Intergenic
1066175317 10:32897481-32897503 GATACATGCTACAACATGCATGG + Intergenic
1067137881 10:43627460-43627482 GATACATGTTACTATATGGATGG + Intergenic
1067332632 10:45335743-45335765 GATGCATGCAACAACTTGGATGG + Intergenic
1067482906 10:46616685-46616707 GATACATGCTACAACATGGATGG + Intergenic
1067611848 10:47724980-47725002 GATACATGCTACAACATGGATGG - Intergenic
1067775880 10:49164609-49164631 GTTTCATGTGACGATATGGAAGG - Intronic
1068425224 10:56852303-56852325 GAAGTATGTGACAACATGGATGG - Intergenic
1068819610 10:61359138-61359160 GATGTATGCCACAACATGGATGG - Intergenic
1069246834 10:66217436-66217458 GATACATGCAACAATTTGGATGG - Intronic
1069499464 10:68937938-68937960 GATGCATGTTGAAATATTTAGGG - Intronic
1070063090 10:73005039-73005061 GATGAAACTTCCAATATGGAAGG + Intergenic
1070065673 10:73031487-73031509 CATACATGCTACAACATGGATGG + Intronic
1070914848 10:80146581-80146603 GATACATGCTACAATACAGATGG - Intergenic
1071627267 10:87185220-87185242 GATACATGCTACAACATGGATGG - Intronic
1072992170 10:100207615-100207637 GATACATGCTACAACATGCACGG + Intronic
1073012160 10:100369528-100369550 GATACATGATACAATAGGGATGG + Intergenic
1073558723 10:104479339-104479361 GATGCATGGAAAAGTATGGAAGG - Intergenic
1074033401 10:109712190-109712212 GATACATACTACAACATGGATGG - Intergenic
1074105467 10:110386356-110386378 GATACATGCTGCAACATGGACGG - Intergenic
1074582239 10:114730961-114730983 CATGCATGCTATAATATGGATGG - Intergenic
1075327344 10:121544518-121544540 GATTCATGCTACAATATGGATGG + Intronic
1076332710 10:129682335-129682357 GATACACGGTACAATTTGGATGG + Intronic
1077644828 11:3914277-3914299 GATGCATGTTGCAACATAGATGG - Intronic
1077757605 11:5050989-5051011 GATGCACGCTACAATATGGTTGG - Intergenic
1078949020 11:16107475-16107497 AATGTATGCTACAATATGGATGG + Intronic
1079166756 11:18051231-18051253 GATACATGCTGCAACATGGATGG + Intergenic
1080651655 11:34227486-34227508 GATACATGCTACAACATGGATGG - Intronic
1081105471 11:39062097-39062119 GACAAATGGTACAATATGGATGG - Intergenic
1081255791 11:40892626-40892648 GATATATGTTACAATGTGAATGG + Intronic
1081563933 11:44244595-44244617 GTTCCATGTAACAATCTGGAAGG + Exonic
1082096368 11:48133794-48133816 GATTTATGGTACAACATGGATGG + Intronic
1083033079 11:59612266-59612288 GATTCATGTTACAGTGTGGCAGG - Intronic
1083461551 11:62816107-62816129 GACGCATGTTAAAATATTTAAGG + Intronic
1084050813 11:66598658-66598680 GATACATGCTACAACATGGACGG - Intronic
1084368718 11:68722110-68722132 GACACATGCTACAACATGGATGG + Intronic
1085078355 11:73612095-73612117 GATGCATGTAATAATTTAGATGG - Intergenic
1085505906 11:77058859-77058881 GATCCATGCTACAACATAGATGG + Intergenic
1085753443 11:79184187-79184209 GACACATGTTATAATATGGATGG + Intronic
1087318120 11:96628636-96628658 GATTCATGCTACAACATGGATGG + Intergenic
1088104966 11:106196389-106196411 GATACATGTTGAAATATGTATGG + Intergenic
1088329663 11:108637904-108637926 GATACATGCTACAACATAGATGG + Intergenic
1088926681 11:114309930-114309952 GACACATGCTACAACATGGATGG - Intronic
1088938442 11:114428129-114428151 GATACATGTTACAATATGGATGG - Intronic
1089918187 11:122180175-122180197 GATGAATTTTACAAGAAGGATGG + Intergenic
1090492080 11:127173499-127173521 CTTGCATGTCACAATATGGGTGG + Intergenic
1090730164 11:129565966-129565988 GATGCATGTTATAATCTCAAGGG + Intergenic
1091686978 12:2569597-2569619 GATCTATGCTACAACATGGATGG - Intronic
1092249915 12:6888414-6888436 GATGCAACTAGCAATATGGAAGG + Intronic
1093374047 12:18402211-18402233 GATATATGCTACAACATGGAAGG + Intronic
1093796909 12:23323192-23323214 GATACGTATTACAACATGGATGG + Intergenic
1095808325 12:46345191-46345213 GAAACATGTTACCACATGGATGG + Intergenic
1097605851 12:61753312-61753334 GATGCATGTTAAATTCTGGGAGG - Intronic
1099385585 12:82009015-82009037 GATTCTTCTTACAATATAGAAGG + Intergenic
1100283377 12:93140050-93140072 AATGCACTATACAATATGGATGG - Intergenic
1102387858 12:112525743-112525765 GATGCACATTGCAGTATGGAAGG - Intergenic
1102449967 12:113034406-113034428 GATACAGGCTACAACATGGATGG + Intergenic
1102888648 12:116540919-116540941 GATTCATGCTACAACATGGATGG - Intergenic
1102981700 12:117246779-117246801 GATACATGCTACAACATGGATGG - Intronic
1103623442 12:122202522-122202544 CATGCATGTTACAAACTGCATGG - Intronic
1104424430 12:128663391-128663413 CATGCATGCAACAACATGGATGG - Intronic
1104764420 12:131317248-131317270 GAAGCATTTTCCAATAAGGATGG - Intergenic
1105466863 13:20651914-20651936 GTTACATGCTACAACATGGAAGG + Intronic
1105848662 13:24315353-24315375 GACACATGTTACAACATGAATGG - Intronic
1106499458 13:30313449-30313471 GAAGCATGTTACAATGTAGGTGG + Intergenic
1106806954 13:33319233-33319255 GATGCATGTTACAATATGGATGG + Intronic
1106961703 13:35006303-35006325 CATGCATGTTATAATATCTAGGG - Intronic
1107463918 13:40631612-40631634 GACACAAGTTACAACATGGATGG + Intronic
1108026787 13:46186319-46186341 GTGACATGTTACAACATGGATGG - Intronic
1108739336 13:53319268-53319290 GAAGCATGCTTCAATATGCAAGG + Intergenic
1109490011 13:63085375-63085397 GATATATGCTACAACATGGATGG + Intergenic
1109933876 13:69254322-69254344 GATACATGCTACAATTTAGATGG + Intergenic
1111502764 13:89144451-89144473 GATACATGCTACAACATGAATGG - Intergenic
1111743787 13:92239460-92239482 CATGCATGCAACACTATGGATGG - Intronic
1111911608 13:94319250-94319272 GATGCATGTTAAAATTTCAAGGG - Intronic
1111959425 13:94793776-94793798 GATACACGCTACAATGTGGATGG + Intergenic
1112386961 13:98948853-98948875 GTCCCATGTTACAATATGGATGG - Intronic
1112708066 13:102094961-102094983 TATGCATGGTACTTTATGGAAGG + Intronic
1112735764 13:102414848-102414870 GCTACATGTAACAGTATGGATGG - Intergenic
1113613205 13:111662583-111662605 GATCCATGCCACAACATGGATGG + Intronic
1114237184 14:20833696-20833718 GTTGCATGTTTTAATATGGGAGG + Intergenic
1114371505 14:22094188-22094210 CATGCATGAAACAATATTGAAGG - Intergenic
1114970000 14:28014239-28014261 GAGGCATGTTACTATAATGATGG + Intergenic
1115149946 14:30272983-30273005 GAAGCATGTTCAAATGTGGAGGG - Intergenic
1115668517 14:35582068-35582090 GATGTATGCTACAACATGAATGG + Intronic
1117710228 14:58520844-58520866 GATACCTGCTACAATATGGATGG - Intronic
1118268712 14:64321124-64321146 GATGAATGCTACAACATAGATGG + Intronic
1118658577 14:67981644-67981666 GGTACATGTAACAACATGGATGG + Intronic
1120024317 14:79565657-79565679 GTTGAATTTTACAAAATGGAAGG + Intronic
1120845902 14:89124723-89124745 GATGCATGCTACAACCTGGATGG - Intergenic
1121212899 14:92222318-92222340 GATCCATGCTACAATGTGAATGG + Intergenic
1121366373 14:93315709-93315731 GATAAATGCTACAATGTGGATGG - Intronic
1121367669 14:93329632-93329654 GACACATGCTACAATATGGATGG + Intronic
1121538711 14:94709081-94709103 AATCCATGTTACAATATGCTGGG - Intergenic
1121746482 14:96298608-96298630 GATACATGCTACAACATAGATGG + Intronic
1122446986 14:101776846-101776868 GACGCACGCTACAACATGGATGG - Intronic
1126466909 15:48969056-48969078 GATGCAAGTTAAAATATGATGGG + Intergenic
1126669393 15:51102495-51102517 AATACATGTTCCAATCTGGAAGG + Intronic
1127197704 15:56607660-56607682 AATGCATATAACAATGTGGAAGG + Intergenic
1127490964 15:59462816-59462838 GATACATGCTACATTATGGATGG - Intronic
1127543818 15:59970354-59970376 GATGCATATTAAAATTTTGAGGG + Intergenic
1127609258 15:60621278-60621300 GATGTTTGTTAAAAAATGGATGG - Intronic
1127920005 15:63486792-63486814 GATACGTTCTACAATATGGATGG - Intergenic
1128167944 15:65483908-65483930 GACACATGGTACAACATGGATGG + Intronic
1129147867 15:73665651-73665673 GATGCAAGTAACAACAGGGATGG - Intergenic
1129549021 15:76428465-76428487 GAGGTTTGTTACAACATGGATGG + Intronic
1129759195 15:78119244-78119266 GACCCATGCTACAACATGGATGG - Intronic
1129860391 15:78856109-78856131 GATACATGCTACCATATGGATGG + Intronic
1133921620 16:10158608-10158630 GATTCATGCTACGACATGGATGG + Intronic
1134391811 16:13826782-13826804 AATGCATGGTACAAGATGAAAGG + Intergenic
1135378293 16:21970118-21970140 GACACATGCTACAATATGGACGG - Intronic
1135701271 16:24634490-24634512 TTTGCATGTTACAATATTTAAGG - Intergenic
1137403499 16:48172174-48172196 GTTACATGCTACAATATGGATGG - Intronic
1137753812 16:50886035-50886057 GATGCATGAGGCAATAGGGATGG - Intergenic
1138021341 16:53484524-53484546 GATACATGCTACAATATGAATGG + Intronic
1140156517 16:72433852-72433874 GATGTATGTTGCAATATTTAGGG - Intergenic
1140438466 16:74967987-74968009 GATACATGCTACAACATGGATGG + Intronic
1140683382 16:77408532-77408554 GCTACATATAACAATATGGATGG + Intronic
1144645263 17:16969391-16969413 GATACCTGCTACAACATGGACGG + Intronic
1144861981 17:18310462-18310484 AATACATGGTACAACATGGATGG + Intronic
1145169424 17:20641671-20641693 GATACCTGCTACAACATGGACGG - Intergenic
1145204122 17:20971830-20971852 GATACCTGCTACAACATGGATGG - Intergenic
1145376717 17:22356538-22356560 GACGCATGCTACAGCATGGATGG - Intergenic
1147540787 17:41357211-41357233 GTTATATGTTACAACATGGATGG + Intergenic
1147718775 17:42525366-42525388 GATGCATGCTACAACATGAATGG + Intergenic
1148016740 17:44527329-44527351 GATACATGTTATGACATGGATGG + Intergenic
1148317070 17:46710987-46711009 TATGCAAGTTACATTATGAACGG + Exonic
1149017550 17:51925775-51925797 GATACATGCTCCAACATGGATGG + Intronic
1149526846 17:57363198-57363220 GATAGATGCTACAATGTGGATGG + Intronic
1150381772 17:64726504-64726526 GATCCATGCAACAATGTGGATGG + Intergenic
1150707457 17:67500336-67500358 GATATATGCTACAACATGGATGG + Intronic
1150774492 17:68068386-68068408 GATCCATGCAACAATGTGGATGG - Intergenic
1150912969 17:69408475-69408497 GATTCAACTTACAATATGGCTGG - Intergenic
1151706050 17:75768303-75768325 GATACGTGTAACAACATGGATGG + Intergenic
1152124740 17:78439633-78439655 GATACATGCTACAACGTGGATGG - Intronic
1152443045 17:80321009-80321031 GACACAAGCTACAATATGGATGG - Intronic
1153385366 18:4488329-4488351 GATACATGCTACAACATGGATGG + Intergenic
1153804149 18:8697528-8697550 GATACATGATCCAATATGGATGG - Intergenic
1153885969 18:9466758-9466780 GACACATGCTACAGTATGGATGG - Intergenic
1153906311 18:9664757-9664779 GACACATGCTACAATGTGGATGG - Intergenic
1155717497 18:28963458-28963480 GATACATGCAACAATGTGGATGG - Intergenic
1156295781 18:35789654-35789676 GATACATGTTACAACATGTATGG - Intergenic
1157426595 18:47589631-47589653 TATGCATGTGACAAAATGGCAGG - Intergenic
1158217309 18:55113498-55113520 TATGCATGTTGCAAGGTGGAAGG - Intergenic
1158352828 18:56580811-56580833 AATGCATGCAACAACATGGATGG + Intergenic
1158886354 18:61830545-61830567 GATACGTGTTACAATGTGGGTGG - Intronic
1159682430 18:71371440-71371462 GATACATGTAACAACTTGGATGG + Intergenic
1163052800 19:14697170-14697192 GATTCATGCTACAACATGGATGG - Intronic
1163147894 19:15394257-15394279 GATACATGCTACAATGTGGCTGG + Intronic
1164780748 19:30889856-30889878 GATACACGTTATAAAATGGATGG + Intergenic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1166058134 19:40306290-40306312 GATGCATGTATCCTTATGGAGGG + Intergenic
1167671283 19:50855157-50855179 GAGGACTGTTGCAATATGGAGGG - Intronic
1168391434 19:56011180-56011202 AATGTATGCTACAAGATGGATGG + Intronic
1168699482 19:58428178-58428200 GATCCATCATACAGTATGGATGG + Intergenic
926178432 2:10617801-10617823 GAGACATGGTACAACATGGACGG + Intronic
926575910 2:14581096-14581118 GATGTTTGTGACAACATGGATGG - Intergenic
927160885 2:20259584-20259606 GATACATACTACAACATGGATGG - Intronic
928441843 2:31298649-31298671 GATGCCTGCTACAAGGTGGATGG + Intergenic
928449114 2:31363008-31363030 GATACATGCTATAATATAGATGG + Intronic
929243666 2:39678418-39678440 GACACACGTTACAACATGGATGG + Intronic
929749994 2:44700948-44700970 GATACATGCTACAACATAGATGG - Intronic
929815281 2:45225719-45225741 GATACATGCTACAATACGGATGG - Intergenic
931260953 2:60618761-60618783 GATGTATGATACAACATAGATGG - Intergenic
931689707 2:64824842-64824864 GTTGCATGTTAGAATAAGCAGGG + Intergenic
932404010 2:71501707-71501729 GACACATGCTACAACATGGATGG - Intronic
933691400 2:85181923-85181945 GATCCATGTTTCAATAGGGAGGG + Intronic
933991629 2:87638231-87638253 GATGCATTTTATAATATGAGTGG + Intergenic
934134898 2:88985907-88985929 GACACATGCTACAACATGGATGG - Intergenic
934235412 2:90227846-90227868 GACACATGCTACAACATGGATGG + Intergenic
934792453 2:97073169-97073191 GAAACAAGTTAGAATATGGATGG + Intergenic
934877109 2:97933310-97933332 GATATATGCTACAACATGGATGG + Intronic
935089316 2:99879298-99879320 GATGGATGTGATACTATGGATGG - Intronic
935876790 2:107515830-107515852 GATACATGAAACAATGTGGATGG - Intergenic
935901315 2:107796745-107796767 GACACATGCTACAACATGGATGG - Intergenic
936302214 2:111312591-111312613 GATGCATTTTATAATATGAGTGG - Intergenic
936748562 2:115612041-115612063 GAGATATATTACAATATGGAAGG + Intronic
938024620 2:127935857-127935879 GATGTGTGCTACAACATGGATGG + Intergenic
938197863 2:129347012-129347034 GATGCATGCCACAACATAGATGG + Intergenic
938581533 2:132650989-132651011 GATGCATGTTATAGCATGGCAGG - Intronic
939434255 2:142153425-142153447 GATAGATGTTAAAACATGGATGG - Intergenic
939482565 2:142767763-142767785 GATGTAAGTTCCAATATTGATGG + Intergenic
939762755 2:146203450-146203472 GATGCATAATTCAACATGGAAGG + Intergenic
940251646 2:151683903-151683925 GATACATGCTACAACATGGGTGG + Intronic
940681013 2:156785116-156785138 GATGCATGTTACATTATTGATGG + Intergenic
940783328 2:157956659-157956681 GATACATGCTACGATATGGATGG + Intronic
941109490 2:161403231-161403253 GATACATGCTACTACATGGATGG + Intronic
941785267 2:169490960-169490982 GATACATGCTACAACATGAATGG - Intronic
941841760 2:170092744-170092766 GATACATGTTACAACATGGACGG + Intergenic
942324038 2:174760391-174760413 GACACATGGTACAACATGGATGG + Intronic
942645241 2:178103207-178103229 GATACATGCTACAATTTAGATGG + Intronic
943888308 2:193251945-193251967 GATACACGTTACAACTTGGATGG + Intergenic
944356807 2:198799812-198799834 GATATATGTTACAATGTGAATGG - Intergenic
944477344 2:200120404-200120426 GAGGCATGTTACATCAAGGATGG - Intergenic
944722444 2:202437769-202437791 GATATATGTTACAACATGGATGG - Intronic
944847071 2:203679785-203679807 CATGCATGTTAAAATATAAAGGG + Intergenic
945156440 2:206844690-206844712 GATGCATGTTAAAGTATTTAAGG - Intergenic
945531022 2:210952252-210952274 GAGGCATGCAACAACATGGATGG + Intergenic
945933783 2:215882708-215882730 GATACATGCTACATCATGGATGG + Intergenic
946793580 2:223326304-223326326 GATACATGCTACATTATGTATGG - Intergenic
947949047 2:234131870-234131892 GAAGCATTTTACAATAGGGGTGG + Intergenic
948004958 2:234600575-234600597 GACACATGCTACAATGTGGATGG + Intergenic
948283491 2:236766852-236766874 GATACATGCCACAATATGGATGG - Intergenic
1168989755 20:2084585-2084607 GATACATGCAACAACATGGATGG + Intergenic
1170109176 20:12786372-12786394 GCTACATGTAACAACATGGATGG - Intergenic
1171201395 20:23244981-23245003 GAGGGATCTTAAAATATGGATGG + Intergenic
1172375855 20:34439741-34439763 GATGTTGGTTATAATATGGAAGG - Intronic
1172905035 20:38362980-38363002 GGTGCATGCAACAATATGCATGG - Intronic
1173612357 20:44379098-44379120 GACACATGCTACAACATGGATGG - Intronic
1174278784 20:49423176-49423198 GATGCATGCCACACCATGGACGG + Intronic
1176057656 20:63157197-63157219 GATGCACGTTACAGCAGGGAGGG + Intergenic
1176057663 20:63157235-63157257 GATGCACGTTACAGCAGGGAGGG + Intergenic
1176702957 21:10080253-10080275 GATGCATATTAAAATAAGAAAGG + Intergenic
1178122111 21:29479692-29479714 GATGCAGTTTGCATTATGGACGG + Intronic
1178941735 21:36912326-36912348 GATACATGTTATAACATGGATGG + Intronic
1179130249 21:38629942-38629964 AATCCATGTTACAAAATGGATGG + Intronic
1179130495 21:38632042-38632064 GAGCCATGTTACAAGATGGGAGG - Intronic
1179236272 21:39549527-39549549 CATACATGCTACAACATGGATGG + Intergenic
1180575086 22:16766044-16766066 GATGCATGTTACAACATGGATGG + Intergenic
1180691449 22:17719863-17719885 GATACATGCTACAACATGGGTGG + Intronic
1180888819 22:19270156-19270178 GATACATGTTATAACATGGATGG + Intronic
1182755921 22:32678947-32678969 GATATTTGTTACAACATGGATGG - Intronic
1182884645 22:33762989-33763011 GATGCATTTGGGAATATGGAAGG - Intronic
1184267036 22:43353804-43353826 GATACATGCTACATCATGGATGG - Intergenic
1185243799 22:49762071-49762093 GATACATGCTAAAATATGGGAGG - Intergenic
949966074 3:9357429-9357451 GATGCATGCTACAATATGGATGG - Intronic
949966172 3:9358389-9358411 GATATATTCTACAATATGGATGG - Intronic
950322377 3:12069071-12069093 GACACATGCTACAACATGGATGG - Intronic
950736693 3:15014766-15014788 GACACATGCTACAACATGGATGG - Intronic
951539470 3:23768610-23768632 GATGCATGCTACAGTGAGGATGG + Intergenic
952304271 3:32131556-32131578 GATACATGCTACAACATGGATGG - Intronic
953264028 3:41368690-41368712 GATACATGCTACAACATGGATGG - Intronic
954703214 3:52463262-52463284 GATTCATGCTACAATATGAACGG - Intronic
957355986 3:79087129-79087151 GATGCATATTAAAACATAGAGGG + Intronic
957881988 3:86228403-86228425 GATGGATGACACAATATGTAGGG + Intergenic
958124939 3:89343611-89343633 GATACATATTTGAATATGGATGG - Intronic
958764130 3:98344220-98344242 GATACATTCCACAATATGGATGG + Intergenic
959589241 3:108058706-108058728 TGTGCATTTTACAATATGAATGG + Intronic
960387175 3:117034393-117034415 GATACATGCTACAACATGGATGG + Intronic
960590213 3:119358679-119358701 GACACATGCTACAACATGGACGG + Intronic
960918880 3:122725952-122725974 GATGCATGTTATAATCTCTAGGG - Intronic
960945059 3:122960660-122960682 GACACATGCTACAACATGGATGG + Intronic
961466957 3:127087905-127087927 GATTCATGTGACACTAGGGAGGG - Intergenic
961624330 3:128249737-128249759 GACACATGTTACAATAAGGATGG - Intronic
962122853 3:132581996-132582018 GATACAAGTTACAATAAGAAAGG + Intronic
962394374 3:135002111-135002133 GATGTATGCTGTAATATGGATGG + Intronic
962734081 3:138308668-138308690 GCTGCATGTAATAAAATGGAGGG - Intronic
963024943 3:140910448-140910470 GATACATGCTACCACATGGATGG + Intergenic
963564724 3:146914719-146914741 AATGCATGTTACATCATGGGAGG - Intergenic
963579919 3:147112428-147112450 TATAAATGTTACAATGTGGAGGG + Intergenic
965498568 3:169429419-169429441 GATGCAAGCTGCAAAATGGAAGG + Intronic
965867834 3:173227194-173227216 CAAGCATGTTAAAATAAGGAAGG + Intergenic
969523073 4:7690095-7690117 GATGGATGATACATGATGGATGG + Intronic
972347925 4:38209290-38209312 GAGAAATGTTAAAATATGGAGGG - Intergenic
974539090 4:63210013-63210035 GAGACATGCTGCAATATGGATGG + Intergenic
974708110 4:65549604-65549626 GATGCATGCTATAATTTGTAGGG + Intronic
975391597 4:73824126-73824148 GATTTATGTTACAACATGGATGG - Intergenic
975795660 4:78004609-78004631 GATGCGTGTTACAACATGGATGG - Intergenic
976768358 4:88622286-88622308 GATACATGCTACAACATGGATGG - Intronic
976898921 4:90148967-90148989 CATGCATTTTAGAATATGAAAGG + Intronic
976901409 4:90181381-90181403 GGTACATGCTACAACATGGATGG + Intronic
977210922 4:94216732-94216754 GATATATGCTACAACATGGATGG - Intronic
977458242 4:97291077-97291099 GATGTATATTACAACATGGATGG - Intronic
977464677 4:97368978-97369000 GATACATTCTACAACATGGATGG - Intronic
977934802 4:102789320-102789342 GATGCATGCTATAATGTGGATGG - Intergenic
980375150 4:131936627-131936649 GATGCATATTAAAATAAGAAAGG + Intergenic
981918369 4:150059537-150059559 GACACATGCTACAAGATGGATGG + Intergenic
982892716 4:160876425-160876447 GGAGAATGTTACAATAAGGAAGG + Intergenic
983045200 4:162978878-162978900 GGTGCATGTAAGAAAATGGAAGG - Intergenic
984299116 4:177892429-177892451 GATGCACGTTTTAATCTGGAAGG - Intronic
984887179 4:184460167-184460189 GATGCATGCTACAACATGGGTGG + Intronic
985015489 4:185629479-185629501 TATTGATGTTACAATATGGCTGG + Intronic
985197316 4:187445427-187445449 GATACATGTTACAACAGGGATGG + Intergenic
987368657 5:17173087-17173109 GATGCATAGAACAACATGGAGGG + Intronic
987804175 5:22741613-22741635 GATCCATCTTACAATACTGAGGG - Intronic
987875862 5:23680539-23680561 GATGCATCCTAAAATATGAATGG + Intergenic
988097230 5:26632083-26632105 TATACATGATACACTATGGAAGG - Intergenic
988895550 5:35669218-35669240 GATTCATGCTACAACATGAAAGG - Intronic
989284307 5:39681657-39681679 GATACATGCTACAACATGGCTGG + Intergenic
989958705 5:50385694-50385716 GATACATGCAACAATTTGGATGG - Intergenic
991284154 5:64951792-64951814 GATACATTCTACAACATGGATGG - Intronic
991431729 5:66554995-66555017 GATACATGCTACAACATGAATGG - Intergenic
992628504 5:78657709-78657731 GAAACATGTTACAACATGGATGG + Intronic
992891269 5:81206518-81206540 GCTCCATTTTACATTATGGATGG + Intronic
994654524 5:102574019-102574041 GATACATGCTACAACATGGATGG - Intergenic
995150034 5:108832359-108832381 GATGCAGGTTAAGATGTGGATGG + Intronic
995579653 5:113583242-113583264 GATGCATATTTAAATATGGAAGG + Intronic
995742260 5:115367310-115367332 GACACATGTTATAATGTGGATGG - Intergenic
996766482 5:127039448-127039470 GATACATGCTACAACATGGATGG + Intergenic
999053887 5:148553165-148553187 GATGCATGAGACAGTATGTAAGG + Intronic
1001511310 5:172324570-172324592 GACTCATGCTACAAAATGGATGG + Intergenic
1001724266 5:173883720-173883742 GATGCATGTCACAGTTTGGAAGG + Intergenic
1003269999 6:4600116-4600138 GATACATGCTACAACATGGATGG - Intergenic
1003301391 6:4886048-4886070 GATACAAGCTACAACATGGATGG - Intronic
1003400457 6:5786413-5786435 GACACATGTTACAACATGCATGG + Intergenic
1003524797 6:6888698-6888720 GACACATGCTACAACATGGATGG + Intergenic
1003548379 6:7080523-7080545 GATTAATGATACAATTTGGAAGG + Intergenic
1003987197 6:11448738-11448760 CACACATGCTACAATATGGATGG - Intergenic
1004922845 6:20393227-20393249 CCTGTATGTTACAACATGGATGG + Intergenic
1005070084 6:21854023-21854045 GACACATGCTACAACATGGATGG + Intergenic
1005209613 6:23445399-23445421 GATGCATTTTCCAACTTGGAGGG - Intergenic
1005657985 6:27963203-27963225 GAAACATGTTACAACATGAATGG - Intergenic
1006587449 6:35125847-35125869 GATATATGCTACAATATGGATGG + Intronic
1006783522 6:36649108-36649130 GATATATGCTACAACATGGATGG + Intergenic
1007087916 6:39163288-39163310 GATGCATGTAACAACTTGGATGG + Intergenic
1007537834 6:42610522-42610544 GATACATGCTACAACATGAATGG + Intronic
1008648109 6:53536117-53536139 GACACATGTAACAACATGGATGG + Intronic
1009326775 6:62360444-62360466 GACACATGCTACAATATGGATGG + Intergenic
1009333458 6:62455400-62455422 GATTCTTGTTACAATTGGGATGG + Intergenic
1009560312 6:65232937-65232959 GACACATGTGACAATATTGATGG - Intronic
1010736088 6:79444887-79444909 GATGCATGAGACACTATGGAGGG - Intergenic
1013457367 6:110342854-110342876 GATACATGCTACAACATGGATGG - Intronic
1013544941 6:111146890-111146912 GATACATGATCCAATATGGATGG + Intronic
1013733704 6:113201856-113201878 TATGCATGTAAAAATATGCAGGG + Intergenic
1014567615 6:122969642-122969664 GATACATGCTACAACATGGATGG + Intergenic
1014788342 6:125643557-125643579 GATGTATGCTACAGCATGGATGG + Intergenic
1016166181 6:140946410-140946432 AAAGCATGTTAAAATATGGTAGG - Intergenic
1016190937 6:141263269-141263291 GATGCATGCTACAACATGGATGG + Intergenic
1016367125 6:143331507-143331529 GATACATGCTACAACATGGATGG - Intronic
1016436056 6:144038667-144038689 GATACATGCTACAACATGGGTGG + Intronic
1018781152 6:167066863-167066885 GATACATGCTACAACTTGGATGG + Intergenic
1020597579 7:10228142-10228164 GATGCATATTATAATATATATGG + Intergenic
1022448376 7:30489936-30489958 GATACATGATACAATGTGGATGG + Intergenic
1022553627 7:31268999-31269021 GATATATGCTACAACATGGATGG - Intergenic
1022768828 7:33447029-33447051 GAAGTATGTTACATTATTGAAGG + Intronic
1023711970 7:43004465-43004487 GACACATGTTATAATATGGATGG - Intergenic
1024962046 7:54986954-54986976 GATACATGCAACAACATGGATGG + Intergenic
1026023019 7:66725491-66725513 GATACATGCCACAACATGGATGG - Intronic
1026515308 7:71064669-71064691 GATGCATGCTACATCATGGAGGG + Intergenic
1026887761 7:73964363-73964385 GATACATGCCACAACATGGATGG - Intergenic
1027253195 7:76412235-76412257 GATGTATGCAACAATTTGGATGG + Intronic
1027595790 7:80172671-80172693 AAAGGATGTTACAATCTGGAAGG - Intronic
1028498834 7:91494766-91494788 GAAACATGCTACAACATGGATGG - Intergenic
1028690840 7:93647853-93647875 GATACAAGTTACAAGATGGTTGG + Intronic
1028939898 7:96509732-96509754 GGGGCATGCTACAACATGGATGG + Intronic
1029471000 7:100754123-100754145 GATGCATGCTACAGTATGGATGG - Intronic
1029935809 7:104423116-104423138 GATGCATGTTACAAGAGGGGAGG + Intronic
1030014816 7:105208470-105208492 GATATATGCTACAACATGGATGG + Intronic
1030971507 7:116063112-116063134 GACACATGCTACAACATGGATGG + Intronic
1031062437 7:117067052-117067074 GATACATGTTACAAAATGGATGG - Intronic
1032317251 7:130849909-130849931 GATTCATGCTACAACATGGGTGG - Intergenic
1032353432 7:131187064-131187086 GCTGGATGTCACAATAAGGATGG - Intronic
1033334039 7:140437274-140437296 AATGCATGTTAAAATTTGGGGGG - Intergenic
1034523163 7:151636452-151636474 GATCCGTGTTACAATGTGAATGG - Intronic
1035228649 7:157447636-157447658 GACACATGCTACAATATGGAGGG - Intergenic
1036461398 8:8956504-8956526 GATGCATGGTACAATGTGGATGG - Intergenic
1036491516 8:9230551-9230573 GATGCAAGTTACAAAATGGCAGG + Intergenic
1036985544 8:13525142-13525164 GATACATGCAACAACATGGATGG - Intergenic
1037070584 8:14642482-14642504 TATGTAAGTTACAATATGTAAGG + Intronic
1037553757 8:20002319-20002341 GATACATGCAACAAAATGGATGG - Intergenic
1038203454 8:25439763-25439785 GATGCATGCTACAACCTGGTAGG + Intronic
1038569886 8:28651969-28651991 GATGCATGCTACAATATGGATGG - Intronic
1039678190 8:39695735-39695757 GCTACATGATACAACATGGATGG - Intronic
1039985090 8:42440440-42440462 GATCCATGTAACAACGTGGATGG - Intronic
1040464551 8:47682207-47682229 GGAGCATGCTACAACATGGAAGG + Intronic
1040465634 8:47692456-47692478 GATACATGTTACATCATGGATGG - Intronic
1041911784 8:63096837-63096859 GATACATACTACAACATGGATGG - Intergenic
1042071052 8:64934241-64934263 AATACATGTTATAATGTGGATGG - Intergenic
1042585745 8:70336369-70336391 GATACATGTTACAATATGGGTGG - Intronic
1042870542 8:73394482-73394504 GATGCATGAAACAACATGGATGG + Intergenic
1044077205 8:87836684-87836706 GATACATGCTATAACATGGATGG - Intergenic
1044651119 8:94497026-94497048 AGTGTATGTGACAATATGGATGG - Intronic
1045373745 8:101550909-101550931 GGTGCATGCTATAAAATGGAGGG - Intronic
1046974626 8:120260314-120260336 TATGCATATCAAAATATGGATGG + Intronic
1047714191 8:127580570-127580592 GATATATGTCACAACATGGAGGG + Intergenic
1047740991 8:127806847-127806869 GATGCATAGAACAACATGGAAGG - Intergenic
1048271425 8:133031269-133031291 GACACATGCTACAACATGGATGG - Intronic
1048666338 8:136665529-136665551 GATGCAGGTGACATTTTGGAAGG + Intergenic
1049140813 8:140952287-140952309 GAAGAAAGGTACAATATGGACGG + Intronic
1051301554 9:15656572-15656594 GATGCATGCAACCACATGGATGG + Intronic
1051723455 9:20064158-20064180 GATACATGTTAAAATATGGATGG + Intergenic
1052014442 9:23448520-23448542 GATACATGCTACAATATGGATGG + Intergenic
1052103694 9:24483951-24483973 GATACATGCTACAACATGGATGG - Intergenic
1052220109 9:26010652-26010674 AATTCATGCTACAATATGGATGG - Intergenic
1053106430 9:35412888-35412910 GATACATACTACAATAAGGATGG - Intergenic
1053640218 9:40067289-40067311 GATGCATATTAAAATAAGAAAGG + Intergenic
1053765916 9:41398188-41398210 GATGCATATTAAAATAAGAAAGG - Intergenic
1054320915 9:63663293-63663315 GATGCATATTAAAATAAGAAAGG + Intergenic
1054544529 9:66309345-66309367 GATGCATATTAAAATAAGAAAGG - Intergenic
1055076082 9:72216511-72216533 GATACATACTACAACATGGATGG + Intronic
1055699313 9:78925318-78925340 GCTGCCTGTTAAAATATGGATGG + Intergenic
1055902780 9:81260237-81260259 GATACATGGTACAACATAGATGG - Intergenic
1056068723 9:82963827-82963849 GAGGCATTTTTCAATATTGATGG + Intergenic
1056200787 9:84274369-84274391 TATGCATTTTGCAAAATGGAAGG - Intergenic
1057864807 9:98671300-98671322 GATGCATGCTACGACATGGATGG - Intronic
1058541426 9:106016302-106016324 GAGGCACTTTACAATATGTAAGG + Intergenic
1058870219 9:109194941-109194963 GATGTATGCTACAATGTGGATGG - Intronic
1058957817 9:109965424-109965446 GATATATGTCACAACATGGATGG + Intronic
1059511079 9:114847627-114847649 GATAAATGTTACAATGTGTATGG + Intergenic
1060539064 9:124417064-124417086 GATACATGTTACAACAGGGATGG + Intergenic
1061058102 9:128235177-128235199 GACACATGCTACAATACGGATGG - Intronic
1061707953 9:132467497-132467519 GACACATGCTACAATGTGGATGG - Intronic
1061710551 9:132484540-132484562 GATCCATGTTACAATGTGGATGG - Intronic
1202787983 9_KI270719v1_random:50362-50384 GATGCATATTAAAATAAGAAAGG + Intergenic
1185753451 X:2632880-2632902 GATGCATGGTACAAAATCGATGG - Intergenic
1186075336 X:5872333-5872355 GATTCATGCTAAAATATGGATGG - Intronic
1186089821 X:6034290-6034312 GATGCATGCTACAGTATGAAAGG - Intronic
1186108899 X:6234908-6234930 GATGCATGTTACATAATTAATGG - Intergenic
1186153100 X:6697003-6697025 GATGTATGGAACAATATAGAAGG + Intergenic
1186202596 X:7169359-7169381 GATACATGCTACAACATGGATGG - Intergenic
1186807894 X:13158524-13158546 GATACATGCTATAATATGGATGG - Intergenic
1187400479 X:18955179-18955201 GATGCATGCTACAACAGGGATGG + Intronic
1188234213 X:27706968-27706990 GATACATGCTACAATATGAATGG + Intronic
1188385382 X:29551117-29551139 GATACATGCTACAACATGCATGG - Intronic
1188678609 X:32974128-32974150 GATACATTCTACAATATGAATGG + Intronic
1189254607 X:39628166-39628188 GACACATGCTACAACATGGATGG + Intergenic
1189459567 X:41228194-41228216 GATACATGCTATAACATGGATGG - Intronic
1190490306 X:50975738-50975760 GATACATGCTACAACATGGATGG - Intergenic
1190520825 X:51277940-51277962 AATGCATGCTACACTATAGATGG + Intergenic
1190795766 X:53739811-53739833 GATGCATGCTACAATTTGGATGG - Intergenic
1191727436 X:64296142-64296164 GATACATGCTGCAACATGGATGG + Intronic
1192559612 X:72117741-72117763 GACGCATGCTATAACATGGATGG - Intergenic
1192868726 X:75164467-75164489 GATACATGCTACAACATGGATGG + Intergenic
1193097808 X:77571391-77571413 GATACATGTGACAACTTGGATGG + Intronic
1193955337 X:87853183-87853205 GATGCATGCAACAACATGGATGG + Intergenic
1194422263 X:93690523-93690545 GATCCATGCTATAACATGGACGG - Intronic
1194525425 X:94970996-94971018 GATACTTGTTGCAACATGGATGG - Intergenic
1195309810 X:103621246-103621268 GATACATGCTACAATATGGATGG + Intronic
1195485929 X:105406068-105406090 GATGCATGCTACAACCTGGTAGG - Intronic
1195515301 X:105767514-105767536 GAGGCAGGTTACAATAAGTATGG - Exonic
1196081286 X:111635377-111635399 GATACATGTAACAATTTGGATGG + Intergenic
1196146519 X:112324232-112324254 GATTTATGCTACAACATGGATGG - Intergenic
1196311787 X:114176491-114176513 GATTCATGCTACAACATGGAGGG - Intergenic
1196766180 X:119245907-119245929 GGTGAATGTTACATTATGCAGGG - Intergenic
1196839759 X:119848668-119848690 GTTATATGTTACAACATGGATGG + Intronic
1197450353 X:126605870-126605892 GATACATGTGACAACATGGATGG + Intergenic
1197791871 X:130263393-130263415 GATACATGTTACAATACTAATGG + Intronic
1197807779 X:130414036-130414058 GATACATGCTACAATGTGGATGG - Intergenic
1198100528 X:133418132-133418154 GATACATGTTACCATATGGATGG - Intergenic
1198112852 X:133517255-133517277 GATACATGCTACAACATTGATGG - Intergenic
1198775097 X:140171306-140171328 TATACATGCTACAACATGGATGG - Intergenic
1199305033 X:146257881-146257903 GACACATGTTACAACATAGATGG + Intergenic
1199577871 X:149332078-149332100 GATACATGCTAAAATATGTATGG + Intergenic
1199757658 X:150880385-150880407 GATCCATGCTACAACGTGGATGG + Intronic
1199867188 X:151862568-151862590 GATACATTTTACAACATGGATGG - Intergenic
1201344969 Y:12972921-12972943 GATACATGCAACAACATGGATGG + Intergenic
1201507437 Y:14718005-14718027 GATGCATGGTACAATATGGACGG + Intronic