ID: 1106807563

View in Genome Browser
Species Human (GRCh38)
Location 13:33326240-33326262
Sequence CCTCACCCACTCCCTATGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 289}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106807558_1106807563 -10 Left 1106807558 13:33326227-33326249 CCCACCTGGCCTTCCTCACCCAC 0: 1
1: 0
2: 1
3: 63
4: 631
Right 1106807563 13:33326240-33326262 CCTCACCCACTCCCTATGCTAGG 0: 1
1: 0
2: 1
3: 23
4: 289
1106807555_1106807563 -2 Left 1106807555 13:33326219-33326241 CCCTCTTCCCCACCTGGCCTTCC 0: 1
1: 1
2: 5
3: 110
4: 1005
Right 1106807563 13:33326240-33326262 CCTCACCCACTCCCTATGCTAGG 0: 1
1: 0
2: 1
3: 23
4: 289
1106807554_1106807563 -1 Left 1106807554 13:33326218-33326240 CCCCTCTTCCCCACCTGGCCTTC 0: 1
1: 0
2: 5
3: 74
4: 745
Right 1106807563 13:33326240-33326262 CCTCACCCACTCCCTATGCTAGG 0: 1
1: 0
2: 1
3: 23
4: 289
1106807557_1106807563 -9 Left 1106807557 13:33326226-33326248 CCCCACCTGGCCTTCCTCACCCA 0: 1
1: 0
2: 12
3: 92
4: 793
Right 1106807563 13:33326240-33326262 CCTCACCCACTCCCTATGCTAGG 0: 1
1: 0
2: 1
3: 23
4: 289
1106807556_1106807563 -3 Left 1106807556 13:33326220-33326242 CCTCTTCCCCACCTGGCCTTCCT 0: 1
1: 0
2: 8
3: 128
4: 957
Right 1106807563 13:33326240-33326262 CCTCACCCACTCCCTATGCTAGG 0: 1
1: 0
2: 1
3: 23
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106807563 Original CRISPR CCTCACCCACTCCCTATGCT AGG Intronic
900409423 1:2506105-2506127 CCACACCCACTCCCACTGTTGGG - Intergenic
900614011 1:3556218-3556240 CCTGCCCCACTCCCCATCCTGGG - Intronic
901193212 1:7424948-7424970 CCTCCCTCCCTCCCTATGCAGGG - Intronic
901302872 1:8212261-8212283 CCCCACCCTCTCCGTGTGCTAGG + Intergenic
902025613 1:13381306-13381328 CCTTCCCCACACCCTATCCTGGG - Intergenic
902478363 1:16699650-16699672 CCTCAGCCTCTCCCTAAGCTGGG - Intergenic
904334709 1:29789520-29789542 CCTCAACGAATCCCTATGCCAGG + Intergenic
904597480 1:31655952-31655974 CCTCTCCGACTCCCCAGGCTGGG + Intronic
905182035 1:36173253-36173275 CCTCCCCCACTCCCTTCCCTTGG - Intronic
905446861 1:38033306-38033328 CCTCAGCCTCTCCAAATGCTGGG + Intergenic
908501876 1:64752131-64752153 TCTCACCCACTCCTTATCCAGGG + Intronic
910436168 1:87208339-87208361 CCTCCCTCACTCCCTTTGCGTGG + Intergenic
913509799 1:119551305-119551327 CATCACCCAGGCCCTGTGCTTGG + Intergenic
914376075 1:147075070-147075092 CCTCAGCCTCTCACTGTGCTGGG - Intergenic
914676937 1:149913048-149913070 CCTCACACACTCCCTCTTCTTGG - Intronic
914778962 1:150766122-150766144 CCTCACCCTCCCCCTCAGCTGGG - Intergenic
914813466 1:151046629-151046651 CCTCCCCCTCTCCCTCTCCTAGG + Exonic
914900346 1:151708092-151708114 TCCCACTCTCTCCCTATGCTAGG + Intronic
919935655 1:202248908-202248930 CCTGGCCCCCTCCCTATCCTGGG + Intronic
920125801 1:203692879-203692901 CATCACCCCCACCCCATGCTGGG - Intronic
921924254 1:220698566-220698588 TCTTTCCCACTCACTATGCTTGG - Exonic
922028513 1:221776144-221776166 CCTCATCAACTCCCCACGCTGGG + Intergenic
922476573 1:225910894-225910916 CCTGACCCACTTCCGGTGCTGGG + Intronic
922704131 1:227780103-227780125 TCTCACCCAGCCACTATGCTGGG - Intronic
923484633 1:234416953-234416975 CCTCTCCCAACCCTTATGCTTGG - Intronic
1065660717 10:28001870-28001892 CCTCCCCCACACCCTATCCATGG + Intergenic
1066016039 10:31244842-31244864 ACTCACCTACTTCCTGTGCTGGG + Intergenic
1067105382 10:43362728-43362750 GCTCACCCCCTGCCTGTGCTAGG - Intergenic
1067668864 10:48301793-48301815 CCACACCCACTGCCTTAGCTTGG - Intergenic
1070826231 10:79391931-79391953 CCTCAGCCACACCCTAGACTTGG + Intronic
1072105903 10:92273721-92273743 CCTTACCCTCACCCTCTGCTGGG - Intronic
1073046632 10:100642937-100642959 CCTCACCCACCCCCACTGCAGGG - Intergenic
1073054032 10:100687526-100687548 CCCCTCCCACTTCCTCTGCTTGG - Intergenic
1073174107 10:101540776-101540798 CCTGAGCCACTCCATCTGCTGGG + Intronic
1073265384 10:102225276-102225298 CCTCAGCCACTGTCTATGCGAGG - Intergenic
1074857357 10:117483235-117483257 CCTCACCCACACCCTCACCTTGG - Intergenic
1075870492 10:125769551-125769573 CCTCATCCACTCTCCATTCTGGG + Intronic
1075871082 10:125773263-125773285 CCTCACCCACTCTCCATTCTGGG + Intronic
1077896073 11:6454542-6454564 CCTTTCCAACTCCCTAGGCTGGG - Intronic
1077938164 11:6812716-6812738 CCTCACCACCTCCTTATCCTGGG + Intergenic
1078406178 11:11071776-11071798 CCTAGCCCAGTCCCTCTGCTTGG + Intergenic
1079594093 11:22220068-22220090 CCTCATCCATTCCCTTTTCTGGG + Intronic
1080604295 11:33851959-33851981 CCACACCCACTCCCCATAATGGG - Intergenic
1080646768 11:34193358-34193380 CCCCACCCCCTCACTATCCTGGG - Intronic
1081614591 11:44583128-44583150 CCCCACTCCCTCCCAATGCTAGG - Intronic
1082881347 11:58041253-58041275 CCCCGCCCACCCCCTAAGCTGGG + Intronic
1084172926 11:67409320-67409342 CCTCAGCCACTTCCTGGGCTGGG + Intronic
1084281232 11:68095789-68095811 CCTCACCCTCTCGCGGTGCTGGG - Intronic
1084419410 11:69052892-69052914 CTTCACCCTCTCCCCGTGCTGGG + Intronic
1085315304 11:75541229-75541251 CCTCAGCCTCCCACTATGCTAGG + Intergenic
1085335261 11:75688402-75688424 CCTCACCACCTCCCTTGGCTGGG + Intergenic
1085727751 11:78968853-78968875 CCTCTCCCTTTCCCTATGCCTGG - Intronic
1090280254 11:125449843-125449865 CCTCACTCACTCCTAATTCTTGG - Intronic
1091403233 12:193470-193492 CCTCACCCCCGCCCTGTGCAGGG + Intronic
1091587493 12:1824561-1824583 CCTCATCCACTCTGGATGCTGGG - Intronic
1091797453 12:3305421-3305443 CCTCCCCTGCTCCCTATTCTGGG + Intergenic
1092070530 12:5627840-5627862 CCTCAGCCTCTCCAAATGCTGGG - Intronic
1092398017 12:8145859-8145881 CCTCACCTCCTCCCTTGGCTGGG - Intronic
1094063554 12:26340451-26340473 CTTCAGCCCCTCCCTATGCCAGG - Intronic
1095907143 12:47390077-47390099 CCTCAGCCTCTCCAAATGCTGGG + Intergenic
1095914196 12:47459369-47459391 AGTCACTCTCTCCCTATGCTGGG + Intergenic
1096259178 12:50080477-50080499 CCTCCCCCAATCCCTGTGCAGGG + Exonic
1096277498 12:50222649-50222671 CCTCTCCCTCTCCCTCTGCCGGG - Intronic
1098781220 12:74688641-74688663 CTTCAGCCACTCCCTCTGTTCGG + Intergenic
1102540431 12:113615094-113615116 CCCTCCCAACTCCCTATGCTTGG - Intergenic
1102551016 12:113692233-113692255 CCTGAGCCACTCCCTTTTCTGGG - Intergenic
1102752775 12:115310155-115310177 CCTCACCCTCTCAAGATGCTGGG + Intergenic
1103722207 12:122980975-122980997 CCTCACCCACCCCCAGCGCTGGG - Exonic
1104847220 12:131852635-131852657 CCCCAGCCGCTCCCTATGCTGGG - Intergenic
1106231654 13:27825618-27825640 CCTCACTCACTCCCCAAGCCTGG + Intergenic
1106419966 13:29577919-29577941 CCTCCTCCACTCCCTCTGCTTGG + Intronic
1106807563 13:33326240-33326262 CCTCACCCACTCCCTATGCTAGG + Intronic
1107314895 13:39120231-39120253 CCTCACCGCCTCCCTTGGCTGGG + Intergenic
1107789903 13:43991300-43991322 TCCCACCCACTCCCTATTCCTGG - Intergenic
1107962163 13:45568149-45568171 TCTCACCCTTTCCCTGTGCTTGG + Intronic
1108843038 13:54643950-54643972 TCTCACCCACTACCCCTGCTGGG + Intergenic
1111978602 13:94993813-94993835 CCTCTCCCACTCACCATTCTTGG - Intergenic
1113416052 13:110129591-110129613 GCACACCCACCCCCTAAGCTGGG - Intergenic
1115513968 14:34166811-34166833 CCTCACCTTCTTCCCATGCTTGG - Intronic
1116671208 14:47845723-47845745 CCTCACCATCTCCCTTGGCTGGG - Intergenic
1117960423 14:61156496-61156518 CCTGTGCCACTCCCTATTCTGGG + Intergenic
1120323555 14:82996324-82996346 CCCCACCCAGTCCCTCTGCTAGG + Intergenic
1121900342 14:97688056-97688078 CCTCAGCCTCTCCACATGCTAGG + Intergenic
1121982495 14:98467245-98467267 CCTAATCCACTCTCTCTGCTTGG + Intergenic
1122774244 14:104110222-104110244 CATCACCCACTCCCCAAGCCTGG - Intronic
1122859024 14:104573977-104573999 CCCCACCCACACCCTGTCCTGGG - Intronic
1124532305 15:30518389-30518411 CCTCATCAACTCCCTCAGCTGGG - Intergenic
1124600189 15:31127532-31127554 CCTCACCACCTCCCTGTCCTGGG - Intronic
1124766348 15:32489256-32489278 CCTCATCAACTCCCTCAGCTGGG + Intergenic
1125373088 15:38999733-38999755 CCTCACCGTCTCCCTTGGCTGGG - Intergenic
1125414870 15:39442012-39442034 CCTCAGACCCTCCCTAAGCTCGG - Intergenic
1127772880 15:62244764-62244786 CCTCAGCAACTCCCTTTCCTGGG + Intergenic
1127838301 15:62808598-62808620 CCTCTCCCACTCCCTACACACGG + Intronic
1128514534 15:68334100-68334122 CAGCCCCCACTCCCTCTGCTGGG + Intronic
1128711853 15:69878180-69878202 CTTCCTCCACTCCCTATACTGGG + Intergenic
1129709645 15:77814009-77814031 TCTCAGCCCCTCCCTGTGCTGGG + Intronic
1129789660 15:78332169-78332191 ACTCACCCACTCACCATGTTTGG - Intergenic
1130551228 15:84891048-84891070 CCCTACCCACTCCCCATCCTGGG - Intronic
1131547500 15:93328121-93328143 CCTCACCCACCCCATTTGGTTGG + Intergenic
1132689972 16:1178007-1178029 CCTCCCCCACTCCCTCTCCCTGG + Intronic
1132710293 16:1263336-1263358 CCCCACCCACTTCCTTTGCAAGG - Intergenic
1133225295 16:4337884-4337906 CCCCACCCACCCCCTCTGCTGGG - Exonic
1133511776 16:6465976-6465998 CCTCAGCCTCTCAATATGCTAGG - Intronic
1135087786 16:19488598-19488620 CTTTTCCCACTCCCTTTGCTTGG + Intronic
1135295750 16:21278072-21278094 CCTCACTCACCCCCTGTGCTTGG + Exonic
1136149952 16:28340874-28340896 CCTCAGCCTCTCCAAATGCTGGG - Intergenic
1136166186 16:28454678-28454700 CCTCAGCCTCTCCAAATGCTGGG - Intergenic
1136187952 16:28599189-28599211 CCTACCCCACTCCCTGTCCTGGG - Intergenic
1136190424 16:28612183-28612205 CCTACCCCACTCCCTGTCCTGGG - Intronic
1136196785 16:28660342-28660364 CCTCAGCCTCTCCAAATGCTGGG + Intergenic
1136213125 16:28774465-28774487 CCTCAGCCTCTCCAAATGCTGGG + Intergenic
1136219971 16:28822818-28822840 CCTTACCCACTCCCAGGGCTAGG + Intergenic
1138207857 16:55138070-55138092 CCTCTCCTACTCACTATGGTGGG + Intergenic
1138223680 16:55274624-55274646 CCTCACCCACTCCACAGCCTCGG - Intergenic
1138725654 16:59135994-59136016 CCTCAGCCTCTCCAAATGCTGGG - Intergenic
1138799691 16:60012883-60012905 CCTCACCCCTTCCATTTGCTGGG - Intergenic
1141233171 16:82190183-82190205 CCCCACCAACTCCCTATTTTGGG - Intergenic
1143385924 17:6530467-6530489 CCTCCCCCACTCCCCAAGGTGGG - Intronic
1143625649 17:8109047-8109069 CCTCAAGAATTCCCTATGCTAGG + Intronic
1143741438 17:8956918-8956940 CCTCGCCCACATCCTCTGCTGGG - Intronic
1143942247 17:10554402-10554424 CATCACCAACTCCCTAGCCTGGG - Intergenic
1144021046 17:11240677-11240699 CCTCACTCACTCACCATGCCCGG - Intergenic
1144560469 17:16316809-16316831 CCCCAACCACTGCCTCTGCTCGG - Intronic
1146059715 17:29598068-29598090 CCTCTCCCACTCCCGCTGCCGGG + Intronic
1146163749 17:30573039-30573061 CCTCACACACACCCTGAGCTGGG + Intergenic
1146289873 17:31599352-31599374 CCTTGCCCAGTCCCTGTGCTGGG + Intergenic
1147194838 17:38759347-38759369 CCAAACCCACTCCTGATGCTGGG - Intronic
1147967258 17:44199906-44199928 CCTCTCCCCCTCCCTCTGCGCGG + Intronic
1150005905 17:61468909-61468931 CCTACCCAACTTCCTATGCTTGG + Intronic
1150532875 17:66003884-66003906 CCCCACCCACCCCCTATCCATGG + Intronic
1151573454 17:74938849-74938871 CCTCAACCACTACCTAGTCTGGG - Intronic
1152564241 17:81093066-81093088 GCCCACCCACTCCCTGGGCTGGG + Intronic
1152616023 17:81338293-81338315 CCCCCCCCACCCCCGATGCTGGG + Intergenic
1154170506 18:12047436-12047458 CCCAACCCACTCCCCATGATGGG + Intergenic
1155543336 18:26888812-26888834 CCTCTCCCCCTCCGGATGCTAGG - Intergenic
1155555891 18:27019023-27019045 CCTGAGCCACGCCCTGTGCTGGG + Intronic
1157006622 18:43590434-43590456 CCTCACCCACTGCCGCTGCAGGG - Intergenic
1157414195 18:47488673-47488695 CCTCACCTCCTGCCTATGGTGGG - Intergenic
1157757519 18:50231918-50231940 CCTTACCCACCCCCTCTCCTGGG + Intronic
1158007684 18:52691812-52691834 CCTCACTCCCACCCTATCCTGGG + Intronic
1160533835 18:79580796-79580818 CCTCTCCCGCTCCATATGCACGG + Intergenic
1160556832 18:79730987-79731009 CCTCTTCCACTCCATGTGCTTGG + Intronic
1161375024 19:3935133-3935155 CCTCAGCCTCTCCAAATGCTGGG + Intronic
1161944306 19:7425431-7425453 CCTCACCCTCTCCAATTGCTGGG - Intronic
1162785290 19:13031080-13031102 CCAGACCCAATCCTTATGCTTGG + Intronic
1163207080 19:15811589-15811611 CTTCACACCCTCCCTCTGCTGGG + Intergenic
1164137538 19:22427955-22427977 CCACACCCGCTCCCTCTGCCTGG + Intronic
1164589624 19:29499549-29499571 CCTCACAGACTCACTATGCAGGG + Intergenic
1165259076 19:34597640-34597662 CCTCACCCACACCCTCTGGCTGG - Intronic
1166033191 19:40148236-40148258 CCCACCCCACTCCCTATGCGTGG - Intergenic
1166051342 19:40262448-40262470 CCTCTGCCACGCCCCATGCTGGG - Intronic
1166107450 19:40604307-40604329 CCGCCCACACTCCCTCTGCTTGG - Intronic
1167239912 19:48337628-48337650 AGTCACCCACACCCTGTGCTGGG + Intronic
1202712385 1_KI270714v1_random:25481-25503 CCTCAGCCTCTCCCTAAGCTGGG - Intergenic
925289790 2:2739846-2739868 CCCCACACACTTCCTGTGCTTGG - Intergenic
927703438 2:25282525-25282547 CTGCACCCTCTCCCTCTGCTGGG + Exonic
928539460 2:32270666-32270688 CCTCCCTCACTCCCTATCCATGG + Intergenic
929536213 2:42785977-42785999 CCTCCCCCACTCTCCAAGCTGGG + Intronic
929587966 2:43127877-43127899 CCTCGCCCAAGCCCTCTGCTGGG + Intergenic
931573970 2:63700033-63700055 CCTCAGCCTCTCACCATGCTAGG - Intronic
932309360 2:70727396-70727418 CCTCTCCCTCTCCCTCTCCTGGG + Intronic
933644141 2:84796539-84796561 CCACACCCTATCCCCATGCTTGG + Intronic
933770097 2:85738264-85738286 TCTCACCCACTCCCTAGGCCTGG + Intergenic
933812692 2:86042913-86042935 CCTCACCCACTGACTAAGCCTGG + Intronic
935325770 2:101935583-101935605 CCTCACACCCTCCCTTGGCTAGG - Intergenic
935901633 2:107799154-107799176 CCACTCCCATTCCCTATGCATGG - Intergenic
937897312 2:126987704-126987726 CCTCAGCCACACCACATGCTTGG + Intergenic
942954805 2:181761635-181761657 CCTCAGCCACTCAAAATGCTGGG + Intergenic
943564837 2:189505199-189505221 CCTCACTCACTCTCTGTGCTGGG + Intergenic
946062799 2:216959327-216959349 CCTCAACCTTTCCCTATTCTTGG + Intergenic
946721350 2:222611838-222611860 CCTCACCCGCACCCTCTGCCTGG + Intronic
1169918306 20:10705894-10705916 CCTCACCCCCTGCCCCTGCTTGG - Intergenic
1170602177 20:17849375-17849397 CCTCACCAACTCCTTACTCTGGG - Intergenic
1170615240 20:17943417-17943439 GCTCTCCCACTCACGATGCTTGG - Intronic
1172629278 20:36367305-36367327 CCTCACCAGCCCCCCATGCTTGG + Intronic
1172965063 20:38828717-38828739 CCTCAACCACTCACTGTGCTGGG + Intronic
1174286000 20:49474042-49474064 CCCCACCCACTCCCGATACGGGG + Intronic
1174489529 20:50882922-50882944 CTTCACACACTCCATATCCTTGG - Intergenic
1175188615 20:57196612-57196634 CATCATTCACTCCCCATGCTGGG + Intronic
1175520724 20:59601138-59601160 CTTCTCCCACTCCCCATCCTCGG + Intronic
1175808581 20:61845247-61845269 CCTCACACCCTCTCTAGGCTGGG + Intronic
1175934372 20:62508268-62508290 CCCCACCCACCCCCTCTGCTGGG - Intergenic
1176901991 21:14453472-14453494 CCACATCCACACCCTATGCAAGG - Intergenic
1179646138 21:42777435-42777457 GCACACTCACTCCCTATGCTGGG - Intergenic
1179889190 21:44327170-44327192 CCTCAGCGTCTCCCCATGCTGGG + Exonic
1183492901 22:38126296-38126318 CCTCACCCACCCCCTGTTGTGGG - Intronic
1183685486 22:39359164-39359186 CCTCAGACCCTCCCTCTGCTGGG + Intronic
1183719593 22:39554729-39554751 CATAACTCACTCCCTATCCTGGG + Intergenic
950469753 3:13177340-13177362 CCCCACCCCATCCCCATGCTGGG + Intergenic
951281332 3:20753481-20753503 CTACCCCTACTCCCTATGCTGGG + Intergenic
952762134 3:36924124-36924146 CCTTACCCACTCCCTCTCCTGGG + Intronic
952777156 3:37057615-37057637 CCTCAGCCTCTCCAAATGCTGGG + Intronic
952894153 3:38065323-38065345 CCTCTCCCTCTCCCTCTGCACGG - Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954237433 3:49267568-49267590 CCTCACCCCCACCCTGTGCTGGG + Intergenic
955702524 3:61696249-61696271 CCTCAGCCACTCACAGTGCTAGG - Intronic
956778462 3:72586085-72586107 CCACCCCCACTCCCCAGGCTGGG - Intergenic
957791685 3:84949787-84949809 CCTCTCCCTCTCCCTAAGCTGGG - Intergenic
958909790 3:99981140-99981162 CCTCACAAACACCCTGTGCTGGG + Intronic
959165231 3:102768670-102768692 CCTCACCCTCTCCCCTTGATAGG + Intergenic
960926079 3:122795627-122795649 CCTCACACAACCCCTATGCCGGG - Intronic
961786291 3:129349033-129349055 CCTTACCAAATCCCTTTGCTGGG - Intergenic
961866389 3:129956377-129956399 CCTCACCCAATCTCTGTGGTAGG + Intergenic
962848640 3:139291229-139291251 CCTCCCTCACTCCCTAAGCCAGG + Intronic
962875072 3:139529713-139529735 CTTCCCTCACTCCTTATGCTTGG - Intronic
964661745 3:159127268-159127290 CCTCCCCAACTCCCTCTGCCTGG - Intronic
964761342 3:160137431-160137453 TCTCACCCACTTCCTAAGCCTGG - Intergenic
966130188 3:176628733-176628755 TCTCACCTACTCCATATGGTAGG + Intergenic
966575161 3:181492902-181492924 GCTGACCCACCCCCTGTGCTAGG + Intergenic
967221732 3:187253101-187253123 CCTCAGCCACTGCCTCTGCAAGG + Intronic
969075868 4:4577250-4577272 CCCCACCTCCTCCCCATGCTAGG + Intergenic
969158811 4:5237205-5237227 CCTGAGCCACTCCCTGTGATGGG + Intronic
969596245 4:8150866-8150888 CATCAGCCACACCCTAGGCTGGG - Intronic
970185433 4:13446576-13446598 CCTCACCGCTTCCCTAGGCTGGG + Intronic
971131177 4:23812759-23812781 CCTCTGCCTCTCCCTTTGCTTGG + Exonic
972860919 4:43168727-43168749 CCTCACCACCTCCCTTGGCTAGG - Intergenic
973680703 4:53315957-53315979 CCTCACCCACTCCAAATACATGG + Intronic
973824552 4:54691947-54691969 ACTCACCCACTTCCTATGTATGG - Intronic
975652981 4:76613103-76613125 CCCCACCAACTCGTTATGCTGGG - Intronic
976078033 4:81321390-81321412 CCTCACCTCCTCCCTTGGCTTGG - Intergenic
976582182 4:86750063-86750085 TCTCTCCCTCTCCCTATCCTTGG + Intronic
977330670 4:95633442-95633464 CCTCACCCTCTCTCTATATTGGG + Intergenic
979359082 4:119740683-119740705 CCTCACCCCCTCCAAGTGCTAGG + Intergenic
979582012 4:122371739-122371761 CCCCACTCACTCCCTTGGCTTGG + Intergenic
980393006 4:132170083-132170105 ACTCACCAACTCCCTTGGCTGGG + Intergenic
983714424 4:170761009-170761031 CCTCAGCCTCTCACAATGCTGGG - Intergenic
986037899 5:3958780-3958802 TCTCACCCATGCCCTATGCTTGG - Intergenic
993019327 5:82572492-82572514 CCTCACCCACTTCCTTGTCTTGG + Intergenic
996129599 5:119765816-119765838 GCTCACCCACACCCTATGAATGG - Intergenic
997657174 5:135564044-135564066 GCCCACCCACTCCAGATGCTAGG - Intergenic
999301401 5:150492896-150492918 CCTCCCCCTCTCCTTATGCCCGG + Intronic
1000823462 5:166014353-166014375 CCTTTGCCACTCCCTCTGCTAGG - Intergenic
1001080249 5:168662323-168662345 AGTCACCCACTGCCTTTGCTGGG - Intronic
1001122131 5:168989493-168989515 CCTCACATTCTCCCTCTGCTCGG - Intronic
1001384732 5:171329517-171329539 CCTGTCCCACTCCCTATGCTTGG - Intergenic
1002191409 5:177479672-177479694 TCTCACCTCCTCACTATGCTGGG + Intergenic
1002320479 5:178372525-178372547 CCTCACCCTCTCCCCTTGCAGGG - Intronic
1002845198 6:939211-939233 CCCCACCACCTCCCTGTGCTTGG - Intergenic
1003095205 6:3137219-3137241 CCTCCCTCCCTCCCTCTGCTCGG - Intronic
1003248666 6:4405568-4405590 ACTCACCGCCTCCCTTTGCTGGG - Intergenic
1004855863 6:19749147-19749169 CCTGACACTCTCCCTATACTTGG - Intergenic
1005341748 6:24849950-24849972 TCTCTCCCACTCTCTCTGCTAGG - Exonic
1005366408 6:25082677-25082699 CCTCACCCACTCTCTCTGTCTGG + Intergenic
1006410481 6:33870703-33870725 CCTCACCCACACCCCATACTGGG - Intergenic
1006443982 6:34068717-34068739 CCTCACCCACTCCCTGCTGTGGG + Intronic
1007345123 6:41223325-41223347 CCTTCCTCACTCCCTCTGCTGGG + Intergenic
1007470538 6:42087256-42087278 CCTCACCCACTCCCTTCTCCTGG + Intronic
1011005367 6:82638315-82638337 CTTCCCCCACTCCCCATCCTCGG - Intergenic
1011304435 6:85910915-85910937 CCTCACCTCCTCCCTTGGCTGGG - Intergenic
1011774334 6:90711639-90711661 CCTCAAACTCTCCCTATGTTTGG + Intergenic
1013242029 6:108255143-108255165 CCTCCCCCACTCTCCATTCTGGG + Intronic
1015776693 6:136822083-136822105 CCAAACCAACTCCCCATGCTTGG - Intergenic
1017277341 6:152584651-152584673 CCTCACCCTCTCAAAATGCTGGG + Intronic
1019409150 7:899082-899104 CGCCACCCACTCCCTCTGGTCGG + Exonic
1020153499 7:5702210-5702232 CCACTCCCACTCCCTCTGCAGGG - Intronic
1022020669 7:26397604-26397626 CCTCACCCCCTCCCTCTCCTTGG - Intergenic
1023981423 7:45072915-45072937 CCTCAGCCATTCACTAAGCTGGG - Intronic
1024222320 7:47298411-47298433 CCTAACCCACTCCCTCTTCTTGG - Intronic
1024377798 7:48658866-48658888 CTTCATCCACTCCCTTTCCTTGG + Intergenic
1026761844 7:73132663-73132685 CCTTACCCACTCACTCTGTTTGG + Intergenic
1027038185 7:74941487-74941509 CCTTACCCACTCACTCTGTTTGG + Intergenic
1027085378 7:75259993-75260015 CCTTACCCACTCACTCTGTTTGG - Intergenic
1029631378 7:101752943-101752965 CCTCAGCCACTCAGAATGCTGGG + Intergenic
1031185924 7:118480277-118480299 CCTCAGCCTCTCCAAATGCTTGG + Intergenic
1032016419 7:128383036-128383058 CCTCCTCCACTCCCCATGCCAGG + Intergenic
1032500041 7:132393241-132393263 ACTCTCCCACTCCCCATTCTAGG + Intronic
1032505480 7:132431322-132431344 CCTCTCCCCCTCCCAATCCTGGG + Intronic
1032858832 7:135858904-135858926 CCTCTCCCACTTCCCATTCTGGG + Intergenic
1033810546 7:145006144-145006166 CCTCACCCATGCCCTTTGCATGG - Intergenic
1034411117 7:150942681-150942703 CCTCACCCACTCTCCAGCCTTGG + Intergenic
1035307298 7:157941717-157941739 CCAGCCACACTCCCTATGCTGGG + Intronic
1035840138 8:2802574-2802596 CCTCATCTTCTCCATATGCTAGG + Intergenic
1036679564 8:10861183-10861205 TCTCCCCCACTCCCAATGCTAGG - Intergenic
1039546271 8:38413561-38413583 CCTCACCCACAGCCCCTGCTGGG - Exonic
1041211921 8:55560147-55560169 ACTCACCGACTCCCTTGGCTGGG + Intergenic
1041474435 8:58248538-58248560 CCTCACCGCCTCCCTTGGCTGGG - Intergenic
1045617914 8:103939416-103939438 CATCACCAAGTCCCTATACTTGG + Intronic
1046063322 8:109165640-109165662 TCTCACCCACTCCCCATCCCTGG + Intergenic
1046942755 8:119946907-119946929 CCTCACCCTCTCCAGATGCCTGG + Intronic
1047326556 8:123843297-123843319 CCACAACTTCTCCCTATGCTAGG - Intergenic
1047903672 8:129450050-129450072 CCTCACCCACTCACTGTTCCTGG - Intergenic
1047925322 8:129677065-129677087 CCTCACCCACTCTTTCTGATTGG - Intergenic
1049187483 8:141265211-141265233 CCTCACCCACAGCCCTTGCTGGG + Intronic
1049494059 8:142921513-142921535 CCTCTTCCAGGCCCTATGCTGGG + Intergenic
1051244437 9:15095445-15095467 CCTCACCTATTCCCTACTCTTGG + Intergenic
1051904031 9:22074711-22074733 CCCCACCCACTACCTCTCCTGGG + Intergenic
1052716883 9:32128472-32128494 CCTCACCGCCTCCCTTGGCTGGG - Intergenic
1052981522 9:34453422-34453444 CCTCACCCTCTCCCAAAGCAGGG + Intronic
1053739996 9:41127671-41127693 CCCCACCCAGGCCCTCTGCTTGG - Exonic
1054442960 9:65283665-65283687 CCCCACCCAGGCCCTCTGCTTGG - Exonic
1054487320 9:65737836-65737858 CCCCACCCAGGCCCTCTGCTTGG + Exonic
1061026067 9:128050582-128050604 CCTCAGCCTCTCACAATGCTGGG - Intergenic
1061062831 9:128259149-128259171 CCTCACCAACTCCCTCACCTGGG + Exonic
1061287257 9:129631115-129631137 CCTCCAGCACTCCCTGTGCTTGG + Intronic
1062259817 9:135655949-135655971 CCTCACCCAGACCCTCTGCCTGG + Intergenic
1186749439 X:12606565-12606587 CCTCAGTCCCTCTCTATGCTTGG + Intronic
1189169032 X:38891261-38891283 CCTCAGCCTCTCCAAATGCTGGG - Intergenic
1190001737 X:46695576-46695598 CCTCCCTGACTCCCTAAGCTAGG + Intronic
1190203764 X:48385121-48385143 CCTCAGCTACTCCATAGGCTGGG - Intronic
1190206772 X:48410282-48410304 CCTCAGCTACTCCATAGGCTGGG + Intronic
1190827310 X:54029407-54029429 CCTCACACACAGCGTATGCTGGG + Intronic
1193190441 X:78563971-78563993 CCTCACCACCTCCCTTGGCTGGG + Intergenic
1193209484 X:78789277-78789299 CCTCACCACCTCCCTTGGCTGGG - Intergenic
1195057630 X:101161889-101161911 CCTCAACCACTCCAAGTGCTGGG - Intronic
1196459073 X:115911494-115911516 CCTCACCCTCTCCCCATACTGGG - Intergenic
1197489473 X:127100340-127100362 CCTCACTGACTCCCTTGGCTGGG - Intergenic
1197871774 X:131068426-131068448 ACTCACTTACTCCCTTTGCTTGG - Intronic
1198260267 X:134959725-134959747 CCTCTCCCTCTCCCTCTCCTCGG + Intergenic
1198665746 X:139020515-139020537 CATCACCCACTCCGTATTATGGG + Intronic
1198907818 X:141582001-141582023 CCCCACCCCTTCCCTATCCTAGG - Intergenic
1198908973 X:141592423-141592445 CCCCACCCCTTCCCTATCCTAGG + Intronic
1198918105 X:141695729-141695751 CCCCACCCCTTCCCTATCCTAGG - Intronic
1199173467 X:144757926-144757948 CCTTACCCTCTCCCTTGGCTGGG + Intergenic
1200372094 X:155738635-155738657 ACTCACCAACTCCCTTGGCTGGG - Intergenic