ID: 1106808393

View in Genome Browser
Species Human (GRCh38)
Location 13:33334762-33334784
Sequence CTTCCATCAGTTATTGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106808393_1106808397 -7 Left 1106808393 13:33334762-33334784 CCATTTCCAATAACTGATGGAAG 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1106808397 13:33334778-33334800 ATGGAAGGACAGCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 27
4: 271
1106808393_1106808401 16 Left 1106808393 13:33334762-33334784 CCATTTCCAATAACTGATGGAAG 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1106808401 13:33334801-33334823 CGGTAAACTAACACCTGGAAAGG 0: 1
1: 0
2: 0
3: 1
4: 83
1106808393_1106808400 11 Left 1106808393 13:33334762-33334784 CCATTTCCAATAACTGATGGAAG 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1106808400 13:33334796-33334818 GCAGGCGGTAAACTAACACCTGG 0: 1
1: 0
2: 0
3: 1
4: 43
1106808393_1106808398 -4 Left 1106808393 13:33334762-33334784 CCATTTCCAATAACTGATGGAAG 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1106808398 13:33334781-33334803 GAAGGACAGCGCCAGGCAGGCGG 0: 1
1: 0
2: 2
3: 45
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106808393 Original CRISPR CTTCCATCAGTTATTGGAAA TGG (reversed) Intronic
902890377 1:19438974-19438996 TTTCCATCATTGATTGGAAACGG - Intronic
902942457 1:19810467-19810489 CTTCCTCCAGTCATTTGAAAAGG + Intergenic
905609794 1:39340492-39340514 ATTCCCTCAGGTATTAGAAAGGG + Intronic
906356819 1:45114547-45114569 TTTCTATCAATTATTGAAAAAGG - Intronic
906919928 1:50053314-50053336 CATCCATCAGTCATCTGAAATGG - Intronic
911162377 1:94694149-94694171 CTTATATCAGTTATAGGCAATGG - Intergenic
911557716 1:99365276-99365298 CTTCCATCAGTTTTTGCACGTGG - Intergenic
912786720 1:112610919-112610941 CTCCCATCAGTGGTTGCAAATGG + Exonic
913658781 1:120988714-120988736 CTTCCATAAGTCATTTCAAATGG + Intergenic
913720677 1:121590079-121590101 GTTCTAACAGTTGTTGGAAAAGG - Intergenic
914010144 1:143771839-143771861 CTTCCATAAGTCATTTCAAATGG + Intergenic
914648766 1:149680498-149680520 CTTCCATAAGTCATTTCAAATGG + Intergenic
914886910 1:151592954-151592976 GTTCCATCAGTAATTCCAAAAGG - Intergenic
915697133 1:157754612-157754634 GATCCATCTGTTACTGGAAAGGG - Intronic
915957950 1:160238906-160238928 CTTCCAGGAGTTAAAGGAAAGGG + Intronic
917466624 1:175283434-175283456 GTTCAATCAATTATTGAAAAAGG - Intergenic
918252447 1:182715454-182715476 CTTCACCCAGTTATTGGAAAGGG + Intergenic
918534556 1:185559859-185559881 CTGCCAGCAGTCATGGGAAAAGG - Intergenic
918596197 1:186296147-186296169 CTTTCCTCATTTATTGGAAAAGG - Intergenic
918662758 1:187109317-187109339 CTTCCAGCAGCTGTTGGAAGAGG - Intergenic
919168384 1:193924262-193924284 CTTCTATCAGTTACTGAAAGAGG - Intergenic
919174025 1:193997313-193997335 CATCCATCAATGACTGGAAATGG - Intergenic
919359359 1:196571261-196571283 CTTCCAACAGATACTGTAAATGG - Intronic
921494230 1:215817734-215817756 CATCTTTCAGTTATTTGAAAAGG + Intronic
922118522 1:222638033-222638055 ATTCTATCAGTTATTGAGAAGGG - Intronic
922330788 1:224573875-224573897 CTTCCATCTTTTTTTGTAAATGG + Intronic
923968542 1:239172797-239172819 GTTCCATCAATTATTGATAATGG + Intergenic
1063947002 10:11187118-11187140 GTTCTATCAGTTATTGAGAAAGG + Intronic
1065422327 10:25559031-25559053 GTTCCATCAGTTATTGAGAGAGG + Intronic
1065900207 10:30199434-30199456 TGTCCTTCAGTTATTGAAAAAGG + Intergenic
1067940976 10:50655861-50655883 TTGCTATCAGTTATTGAAAAAGG - Intergenic
1068425557 10:56858653-56858675 TTTTCATCAATTATTGAAAAAGG - Intergenic
1069107695 10:64404019-64404041 CTTACAGCAGATATTGTAAATGG + Intergenic
1070862192 10:79680707-79680729 TTGCTATCAGTTATTGAAAAAGG - Intergenic
1072085812 10:92077991-92078013 CTTCCATGTGATATTGGAAAAGG - Intronic
1072351035 10:94557395-94557417 CTTTCATCACCTCTTGGAAATGG + Intronic
1073061084 10:100734383-100734405 CTTCCCTCAGGAATAGGAAAGGG - Intergenic
1073694971 10:105855177-105855199 TTTCAATCAGTTATTGCCAAAGG + Intergenic
1074381679 10:112985780-112985802 CTACCAGCATTTTTTGGAAAGGG - Intronic
1077476601 11:2793248-2793270 TTTCCACCCGTTATTGGATATGG - Intronic
1077777526 11:5288044-5288066 CTTCTTTCAGTTAGAGGAAAAGG - Intronic
1079020179 11:16903910-16903932 CTTCCTTCAGAGACTGGAAAAGG + Intronic
1079125776 11:17717987-17718009 CTTCCAGAAGTTAGTGGGAAAGG + Intergenic
1079863620 11:25706893-25706915 CATCCATCAGTTATTGAATGAGG - Intergenic
1079884882 11:25974866-25974888 CTCCCCTCAGTTATTTGGAAAGG - Intergenic
1085190182 11:74613784-74613806 CTCCCATCAGTTACATGAAAAGG - Intronic
1085511103 11:77088571-77088593 CTTCCATCTGGGACTGGAAAGGG - Intronic
1085847781 11:80085437-80085459 CTTCCATCAGTCATTGGCTGAGG - Intergenic
1085922998 11:80981531-80981553 CTTCAATTTGTTATTGGAAAAGG - Intergenic
1087212762 11:95460418-95460440 CTTCCCTCATGTATTGGGAAGGG - Intergenic
1087370735 11:97280205-97280227 CTTCCATCAGTTTTTGGTGAAGG - Intergenic
1088797291 11:113274457-113274479 CCTCCATCAGTTCCAGGAAAGGG - Intronic
1089178103 11:116562784-116562806 CTTCCAGCAGGTGTTGGACAAGG - Intergenic
1089211590 11:116807680-116807702 ATTCCATCAGTTTGAGGAAATGG - Intergenic
1092645727 12:10569939-10569961 GTTCCATCAGTAATTCCAAAAGG - Intergenic
1093139608 12:15493153-15493175 CTTTCACCAGTTATTGCAGAAGG - Intronic
1093724216 12:22484715-22484737 GATGCAACAGTTATTGGAAAAGG - Exonic
1094051158 12:26222217-26222239 TTTCCATCATTGAATGGAAATGG - Intronic
1095354141 12:41251648-41251670 CTTCAAACAGTTCATGGAAAAGG - Intronic
1098131017 12:67349908-67349930 CTTCCAAAAGATATTTGAAATGG + Intergenic
1098194752 12:67987877-67987899 TTTATATCCGTTATTGGAAAAGG - Intergenic
1099540754 12:83904638-83904660 CTTCCATCAGTGAAAGCAAAGGG + Intergenic
1102186822 12:110955312-110955334 CTTCCTTCATTTGTTTGAAATGG - Intergenic
1104135544 12:125934443-125934465 CTTCCTTTAGTTTTAGGAAAAGG - Intergenic
1106732937 13:32560737-32560759 CTTCCTTCATTTAATGGAATTGG + Intergenic
1106808393 13:33334762-33334784 CTTCCATCAGTTATTGGAAATGG - Intronic
1107352963 13:39535152-39535174 CATCCATCATATATTGGAGAAGG + Intronic
1107608607 13:42089182-42089204 GTTCTATCAGTTATTGAAAAAGG - Intronic
1108310074 13:49180261-49180283 CTTTTATCATTTATTTGAAATGG - Intronic
1110173079 13:72525390-72525412 CTTACATTAGCTTTTGGAAAAGG + Intergenic
1110721423 13:78766496-78766518 CCTCCACCAGTCATTGGGAAGGG - Intergenic
1111202062 13:84950891-84950913 TTTCCATCATTTATGTGAAAAGG - Intergenic
1111874144 13:93872388-93872410 CTTACAGCAGTTATAAGAAATGG - Intronic
1114128022 14:19753617-19753639 CTTCCATTACTTAGAGGAAATGG + Intronic
1114963732 14:27929217-27929239 CCTCCTTCTGTTATAGGAAAGGG - Intergenic
1115332167 14:32210091-32210113 CTTTCATCAGTTATTCAAAGAGG + Intergenic
1116530930 14:45972557-45972579 CTTCCATCACTAATTAGAAGTGG + Intergenic
1117579159 14:57134458-57134480 CTCCCATTATTTATTAGAAATGG + Intergenic
1118020278 14:61705505-61705527 CTACCCTCAGATATTTGAAAAGG - Intronic
1118425460 14:65655706-65655728 CTTCCATCAATTATTGAAAGAGG - Intronic
1119163971 14:72477040-72477062 CCTCCAGCAGTTACTAGAAAAGG + Intronic
1120037245 14:79711829-79711851 CATCCATCATTAATTGGATATGG - Intronic
1120680428 14:87474360-87474382 CTTCCATGAGTTATAGGTGAGGG - Intergenic
1120763358 14:88305933-88305955 CTTCCATCAGTTATTGGTTGAGG + Intronic
1122076485 14:99238276-99238298 CTTCCACCAGAGATTGGAAAGGG + Intronic
1122654179 14:103246227-103246249 CTTCCTGCAGTTATTTCAAAGGG + Intergenic
1123607592 15:22050511-22050533 CTTCCATTACTTACAGGAAATGG + Intergenic
1124213036 15:27779333-27779355 GTTCCATCTATTATTGAAAATGG + Intronic
1125002755 15:34788387-34788409 TTTCCATCTGTGATTAGAAATGG - Exonic
1125077493 15:35636546-35636568 CTTCCAGCAGTGATTGGCAGAGG - Intergenic
1125081077 15:35673716-35673738 GCACCAGCAGTTATTGGAAATGG - Intergenic
1125215255 15:37264795-37264817 CTTCTATCAATTATTGAAAGAGG - Intergenic
1126235834 15:46383106-46383128 CTTCAATCAGTCATTGAACATGG - Intergenic
1127212203 15:56784804-56784826 CTTCCTTCAGTTACTGGAAAGGG - Intronic
1127912405 15:63428229-63428251 CTTCCATCAGTCATTGGTGAGGG + Intergenic
1128539971 15:68520341-68520363 GTTCCATCAGTTACTGAAAGAGG + Intergenic
1128685167 15:69678909-69678931 CTTCTATCAGTAATTCCAAAAGG + Intergenic
1202979828 15_KI270727v1_random:342313-342335 CTTCCATTACTTACAGGAAATGG + Intergenic
1133463801 16:6010291-6010313 TTTCCATCACTTATTGGTGACGG - Intergenic
1133802577 16:9095849-9095871 CTTCCTTCCTTTTTTGGAAAGGG - Intronic
1134866314 16:17610475-17610497 GTTCCATCAGTAATTGCAAAAGG - Intergenic
1135919935 16:26640889-26640911 CATCCCTCAATTATTAGAAAAGG + Intergenic
1137899035 16:52245212-52245234 CATCCATCAGTTATTGAATAAGG + Intergenic
1138841937 16:60520643-60520665 CTAACATCATTTATTGAAAAGGG - Intergenic
1140283617 16:73579002-73579024 GTTCCATCAGTAATTCCAAATGG - Intergenic
1141157636 16:81608504-81608526 CTTCCATGAGATTTTGTAAAAGG - Intronic
1141781100 16:86161991-86162013 GTTCTATCAGTAATTGCAAAAGG + Intergenic
1141783649 16:86182787-86182809 GTTCCATCAATTATTGGGATAGG - Intergenic
1143289351 17:5817209-5817231 CTTCTATCAGTCTTTGCAAAGGG - Intronic
1145052501 17:19673897-19673919 CATACATCATTTCTTGGAAAAGG + Intronic
1146741986 17:35294348-35294370 CCACCATCATTTATTGAAAAGGG - Intergenic
1148835925 17:50465736-50465758 CTTCCAGGGGTTATTGGTAAGGG + Exonic
1150966534 17:69976063-69976085 ATTTCATCACTTATTGGAATAGG + Intergenic
1153077296 18:1178569-1178591 TTTCTATCAATTATTGAAAATGG - Intergenic
1156094713 18:33515801-33515823 CTTCCAGCAGTTGATGAAAATGG - Intergenic
1156170879 18:34483759-34483781 ATTCTATCAATTATTGAAAAAGG - Intergenic
1163249501 19:16118028-16118050 CTCCCATCAGCTCTTGGAGAGGG + Intronic
1163673328 19:18642159-18642181 GTTCCTTCATTTATTGCAAATGG + Intronic
1167200818 19:48063844-48063866 CCTTCATCAGTTACTGGAAAGGG + Intronic
1168088960 19:54069414-54069436 CTTGGATCTGTTACTGGAAAGGG + Intergenic
926554207 2:14338090-14338112 GTTCTATCAATTATTGAAAATGG + Intergenic
928946140 2:36773863-36773885 CTTTCATCAGTGGCTGGAAAGGG - Intronic
930232136 2:48854010-48854032 CTTCCATCAGTGACAGGAATAGG + Intergenic
933373700 2:81450883-81450905 TTTCCATCAGTCATTGCACATGG - Intergenic
933777080 2:85777616-85777638 AGTGCATCAGTTATTGGGAAAGG + Intronic
935463236 2:103363767-103363789 TATCCATCTGTAATTGGAAATGG + Intergenic
936379498 2:111971869-111971891 GTTCCATCTGTTATTGAAAATGG + Intronic
937608866 2:123836052-123836074 CTTACATCAGTGATTTGCAAAGG - Intergenic
939426829 2:142049800-142049822 CTTCCATCAGGTATAAGTAATGG + Intronic
940134208 2:150417677-150417699 CATCCCTCTGTTACTGGAAAGGG + Intergenic
940824313 2:158393456-158393478 CTTTCATCAATTATAGGGAAAGG + Intronic
941600112 2:167532591-167532613 CTTCTCTTAGTTTTTGGAAAAGG + Intergenic
942399063 2:175581702-175581724 TTTCCATCAGTCATGGAAAATGG + Intergenic
942433097 2:175937078-175937100 CTCCCAACAGTTTTTAGAAAAGG + Intronic
944410260 2:199434250-199434272 TTAACATCAGTTACTGGAAAGGG + Intronic
946638763 2:221760108-221760130 CTGGCAACATTTATTGGAAAGGG + Intergenic
1169291124 20:4353872-4353894 CTTTCAGGAGTGATTGGAAAAGG - Intergenic
1170349041 20:15419269-15419291 CACCCATCAGTCATTGGTAAAGG + Intronic
1171017913 20:21558247-21558269 TTTCCATGACTTACTGGAAAAGG - Intergenic
1172060091 20:32181551-32181573 CTTGAATTAGTTATTGGCAAGGG - Intergenic
1172866316 20:38101673-38101695 ATTCTATCAATTATTGGGAAGGG - Intronic
1172934797 20:38612327-38612349 CTTGTTTCAGTTACTGGAAAAGG - Intronic
1175072111 20:56343558-56343580 CTTCCACCAGCTATTGGCAGGGG - Intergenic
1175671642 20:60908472-60908494 CTTTCAACTGTTTTTGGAAACGG + Intergenic
1177380338 21:20332732-20332754 CCTTCATCAGTTAATGAAAAAGG - Intergenic
1177752663 21:25304953-25304975 CTGCCATCAGTTGTTTGAAATGG - Intergenic
1177817642 21:25995174-25995196 TTTCCATCAGTTATTAAAAATGG + Intronic
1178076302 21:29016183-29016205 GTTCCAACAGTTATTAGAAGAGG - Intronic
1178380221 21:32101389-32101411 CTTCCATCTGTTATTCCAACAGG + Intergenic
1179484231 21:41699512-41699534 CTTCCATCAGAGGCTGGAAAAGG - Intergenic
1181564652 22:23727916-23727938 CATCCATCACTGGTTGGAAAGGG - Intergenic
1181980949 22:26766003-26766025 CATCTATCAGTCATTGGATATGG - Intergenic
1184227063 22:43135124-43135146 TTCACATCAGTTGTTGGAAAGGG + Intronic
1185175077 22:49321777-49321799 CTTCCATCTGCTGTGGGAAACGG + Intergenic
1185399687 22:50609361-50609383 CTTCTGTGAGTTAATGGAAAGGG + Intronic
949578941 3:5366933-5366955 CTTCCATCAGAAAGAGGAAATGG - Intergenic
949677656 3:6475407-6475429 CTTTCATCAGTTTTTCAAAAGGG + Intergenic
950832507 3:15888699-15888721 CTTCCACCAGTTATTGCTTAGGG + Intergenic
951045054 3:18028639-18028661 CACCCATCAGTCATTGGGAAGGG - Intronic
951465544 3:22997202-22997224 CTTCTATCAGTCATTGGCTAAGG - Intergenic
951802917 3:26616616-26616638 TTCTCATCAGTTATTGGTAATGG + Intergenic
952468129 3:33613359-33613381 CATCAATCAGTTATTGGATATGG + Intronic
952559056 3:34568425-34568447 CATACATAAGTTACTGGAAAGGG + Intergenic
954407101 3:50351300-50351322 CTACCATAACTTATTGGAAGAGG + Exonic
956085995 3:65609875-65609897 CTTCCTTCAGTTTTTTTAAAGGG + Intronic
956692895 3:71894046-71894068 CTTCCATCACTCATTGGTTAAGG - Intergenic
957179069 3:76852636-76852658 TTTCCATCAGTTATTTTTAAGGG - Intronic
957757610 3:84510491-84510513 CTTCCATCTGTGAAGGGAAAGGG - Intergenic
960125058 3:113989214-113989236 CTTCTATCAGTTATTGAGAGAGG - Intronic
960689425 3:120328703-120328725 CTCCAATCAGTTATGAGAAAAGG + Exonic
960808468 3:121606659-121606681 CTTCCATATGTTAATGCAAAAGG + Intronic
962421371 3:135232081-135232103 CTTCTAACAGCTAGTGGAAATGG - Intronic
963825758 3:149951392-149951414 CATTCATGAGTTATTTGAAAAGG + Intronic
964469774 3:157040497-157040519 CTGCCAAAAGTTAGTGGAAATGG - Intronic
965091685 3:164171072-164171094 ATTTCAACAGTAATTGGAAAAGG + Intergenic
966013626 3:175113663-175113685 TTTTCATCACTTGTTGGAAATGG - Intronic
967533352 3:190574527-190574549 CTGCAGTCAGTCATTGGAAAAGG - Intronic
969204592 4:5633863-5633885 CTTCTGTGAGTTATTGGAAGTGG - Intronic
970909877 4:21262457-21262479 CATCCATCAGTCATTGGCTAAGG - Intronic
974424333 4:61721343-61721365 CTTACATCAGTGATTTGCAAGGG - Intronic
974541424 4:63242906-63242928 GTTCCATCTATTATTGAAAATGG - Intergenic
975964774 4:79958688-79958710 CTTTAAGCAGTTAATGGAAAAGG + Intronic
976232807 4:82863069-82863091 CTTTCATCATTCTTTGGAAATGG - Intronic
977178982 4:93849943-93849965 GTTCTATCAATTATTGAAAAAGG - Intergenic
977411167 4:96666206-96666228 TTTCCATCTGTTATAGAAAAAGG + Intergenic
977586787 4:98783363-98783385 TTTCCAGCAGGAATTGGAAATGG + Intergenic
977948977 4:102947706-102947728 CATCAATAGGTTATTGGAAATGG + Intronic
978653109 4:111031889-111031911 CTTCCTTCAGCTATTTCAAAAGG - Intergenic
980321479 4:131284782-131284804 CTTCCATAAAGGATTGGAAAAGG - Intergenic
981097165 4:140793467-140793489 CTGCCATCTGTTCTTGGAAAAGG + Intergenic
984035453 4:174662304-174662326 TTTCCATCTTTCATTGGAAATGG + Intronic
984125951 4:175810826-175810848 TTTTCATCAGTGATTGTAAATGG - Intronic
986807044 5:11317861-11317883 CTTCCATCAGATGTCTGAAAGGG + Intronic
988137005 5:27186838-27186860 CTGCCAACAGTAATTGGAATAGG + Intergenic
988910711 5:35839079-35839101 CTTCAATCAGATATTAGAATGGG + Intergenic
991281590 5:64920510-64920532 CGTCCCTCAATTTTTGGAAAAGG + Intronic
993730177 5:91412908-91412930 CTTCCTTCAGTTGCTGCAAAAGG + Intergenic
993792763 5:92227106-92227128 CTCCCTTCAGTTATTGTAAGAGG + Intergenic
994533126 5:100992190-100992212 CTTCCATAAGTCATTCCAAATGG + Intergenic
994818938 5:104623494-104623516 CTTCCCTCAGATTTTGGAGAGGG + Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995434350 5:112119102-112119124 CTTCCAGCAGTTGATGAAAAAGG + Intergenic
995689213 5:114804735-114804757 CTTCAAACAGATATTTGAAATGG + Intergenic
995889511 5:116935020-116935042 CATCCATTAGTCATTGGACAGGG + Intergenic
996319445 5:122198078-122198100 CATCAATCAGTCATTGGATATGG - Intergenic
996342107 5:122450704-122450726 CTTACGCCAGTTATTGGGAAAGG + Exonic
996962248 5:129264916-129264938 ATTTCACCAGTTTTTGGAAAGGG + Intergenic
997251436 5:132391714-132391736 GTTCTATAAATTATTGGAAATGG - Intronic
997790069 5:136750936-136750958 TTTCCATCTGTTATTGAATAAGG + Intergenic
999593794 5:153179669-153179691 GATCTTTCAGTTATTGGAAAAGG - Intergenic
1000104264 5:158043885-158043907 CTTCCATCAGTTATTGCTTTAGG + Intergenic
1000891297 5:166805313-166805335 CTTCCATCAATAGCTGGAAAAGG - Intergenic
1001579851 5:172791157-172791179 CTGCCATTACTAATTGGAAATGG + Intergenic
1003111738 6:3256794-3256816 CCTCCATCAGTTATTGTATGTGG + Intronic
1004257411 6:14077949-14077971 CATCCAGCTGTTACTGGAAAAGG - Intergenic
1004863498 6:19831489-19831511 ATTTCATCACTTGTTGGAAATGG - Intergenic
1006016984 6:31089460-31089482 CTTACATCAGATATTTAAAATGG - Intergenic
1008007230 6:46423769-46423791 ATGCCTTCAGTGATTGGAAAAGG - Intronic
1010660229 6:78561914-78561936 CTCCCAGCAGTTTTTGGGAATGG + Intergenic
1011104290 6:83761865-83761887 CTGCCATCAGTCATTGGATGTGG - Intergenic
1012068725 6:94583752-94583774 GTTCCATCAGTTTCTGCAAAAGG + Intergenic
1012282497 6:97345349-97345371 CTTCTATCAGTTATTGGCTGAGG + Intergenic
1012616684 6:101285979-101286001 CCTGCTTCAGTTATTGGTAAAGG + Intergenic
1013322299 6:109006264-109006286 CTTTCATCAGTTATGCTAAATGG - Intronic
1014501186 6:122191378-122191400 CTGCAATCATTTATTGTAAAAGG + Intergenic
1014975129 6:127870909-127870931 CTTCTATCAGTTGTTGAAAGAGG - Intronic
1015305907 6:131708115-131708137 GTTCTATCAATTATTGAAAAAGG + Intronic
1016212566 6:141557043-141557065 CTTCAGTCATTTATTGGCAAAGG - Intergenic
1018238356 6:161748559-161748581 ATTCCATCAGTCCATGGAAATGG + Intronic
1021145390 7:17082336-17082358 GTTCTATCAGTTGTTGGATAGGG + Intergenic
1021799862 7:24294431-24294453 CTTCCAGCAGTGAATGCAAATGG + Intergenic
1023527222 7:41117368-41117390 CATTCATCAGTGATTGGAACAGG - Intergenic
1023910365 7:44551111-44551133 GTTCCATCAATTATTGAAAATGG - Intergenic
1026083941 7:67247108-67247130 CTTCTATCTATTATTGGAAGTGG - Intergenic
1026693091 7:72566919-72566941 CTTCTATCTATTATTGGAAGTGG + Intronic
1027601596 7:80246923-80246945 CTTCTATCAGTAATTCCAAAAGG + Intergenic
1027807357 7:82845377-82845399 CTGTCATCAGTTGTTGAAAAAGG - Exonic
1027997650 7:85446196-85446218 CTTATAGCAGTTATGGGAAATGG - Intergenic
1031076413 7:117217355-117217377 CAGCCATCATTTATGGGAAATGG + Intronic
1033731643 7:144186385-144186407 GTTCTATCAATTATTGAAAAAGG - Exonic
1033740022 7:144266348-144266370 GTTCTATCAATTATTGAAAAAGG + Intergenic
1033834684 7:145294952-145294974 TTTCCAGCAGGTATAGGAAAAGG + Intergenic
1034407815 7:150916942-150916964 CTTCCATTAGTCTTTGGATATGG - Intergenic
1034752191 7:153580059-153580081 CTTCCTTCATTTTTTGGAATAGG - Intergenic
1034875224 7:154719651-154719673 CTTCCAGCAGGCATTGGACAGGG + Intronic
1036208903 8:6826411-6826433 CTTCCAGCAGTAATTGGTGAAGG + Intronic
1040921807 8:52629128-52629150 CTTCTCTCAGTGATTTGAAAGGG - Intronic
1041398436 8:57416799-57416821 CTTTCATCAGTCATTTGAAAAGG + Intergenic
1043006181 8:74821482-74821504 CCTGAATCAGCTATTGGAAAAGG - Intronic
1043990621 8:86749449-86749471 CATCCATCTGTTATTGAAAGTGG + Intergenic
1047269893 8:123346678-123346700 GTTCCATCAGTTTATGAAAATGG - Exonic
1047635462 8:126756824-126756846 CTTCCATCAGTTCTTCAAAAGGG + Intergenic
1050070288 9:1804059-1804081 TTTTGATCAGTTAATGGAAATGG - Intergenic
1050079525 9:1901672-1901694 TTTCCTTCAGCTATTGTAAATGG - Intergenic
1050297009 9:4215675-4215697 CTTTCAGTAGGTATTGGAAATGG - Intronic
1050547896 9:6724464-6724486 CATCCATTATTTAATGGAAATGG + Intronic
1051180835 9:14410396-14410418 TTTGAATCATTTATTGGAAAGGG + Intergenic
1051700276 9:19815308-19815330 CTTCCATAACAGATTGGAAAAGG - Intergenic
1053513126 9:38706416-38706438 CGTCCATCAGTCACAGGAAAGGG - Intergenic
1055000435 9:71443456-71443478 CTTCCTTCAGCTATTGCACAGGG + Intronic
1057044299 9:91873057-91873079 ATTCCAACAGATATTGGATAAGG + Intronic
1057364841 9:94409986-94410008 GTTCTATCAGTTACTGAAAATGG + Intronic
1057658489 9:96978107-96978129 GTTCTATCAGTTACTGAAAATGG - Intronic
1058989352 9:110240189-110240211 CTTCCAGCAGTTACTGTGAAAGG - Intergenic
1059572105 9:115449914-115449936 GTTCTATCAATTATTGAAAAAGG + Intergenic
1061468126 9:130799417-130799439 TTTCCATGGGTTATTGGACATGG - Intronic
1185990171 X:4885693-4885715 CTTACATAATTTATTGGATATGG - Intergenic
1186222396 X:7363843-7363865 TTGCCATCAGTTATTCAAAATGG + Intergenic
1189965434 X:46367941-46367963 CTTCCAGCTGTCACTGGAAAGGG + Intergenic
1192901164 X:75498530-75498552 CTTTATTCAGTTATTGTAAAAGG - Intronic
1193237418 X:79125014-79125036 CTTTTATCAGTTATTGAAAGGGG - Intergenic
1193258329 X:79376749-79376771 CTTAAATCAATTATTGGCAAAGG + Intergenic
1193364610 X:80616896-80616918 CTTTCATCAGTTCTGGAAAAAGG + Intergenic
1193512398 X:82419339-82419361 ATTCTGTCTGTTATTGGAAATGG - Intergenic
1194006090 X:88494507-88494529 GTTCCATCCATTATTGAAAATGG + Intergenic
1196365772 X:114921999-114922021 CATCCATAGGTTCTTGGAAATGG - Intergenic
1196857172 X:119995197-119995219 ACTCCATCACTTATGGGAAATGG + Intergenic
1197307366 X:124860002-124860024 CTTACTTCATTTATAGGAAAGGG - Intronic
1198276864 X:135103018-135103040 CTTCTATCAGTAATTCCAAAAGG + Intergenic
1198822515 X:140664102-140664124 CTTTCATCACTTATTTCAAATGG + Intergenic
1198825643 X:140695448-140695470 CTTTCATCACTTATTTTAAATGG - Intergenic
1199564651 X:149202245-149202267 GTTCTATCTGTTATTGAAAATGG + Intergenic
1200341840 X:155405603-155405625 CTTCTATCAGTTACTGAAGAAGG - Intergenic
1201965013 Y:19723171-19723193 CTACCATCTGTTATTTGACAAGG + Intronic