ID: 1106809846

View in Genome Browser
Species Human (GRCh38)
Location 13:33349508-33349530
Sequence GAGCATGCACAGAAGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 336}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106809843_1106809846 -1 Left 1106809843 13:33349486-33349508 CCTACAGAAAGAGGGCTCCATGG 0: 1
1: 0
2: 2
3: 18
4: 172
Right 1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG 0: 1
1: 0
2: 6
3: 36
4: 336
1106809837_1106809846 16 Left 1106809837 13:33349469-33349491 CCCACTGCATCCTTGGCCCTACA 0: 1
1: 0
2: 5
3: 342
4: 17462
Right 1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG 0: 1
1: 0
2: 6
3: 36
4: 336
1106809836_1106809846 19 Left 1106809836 13:33349466-33349488 CCGCCCACTGCATCCTTGGCCCT 0: 1
1: 0
2: 2
3: 57
4: 488
Right 1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG 0: 1
1: 0
2: 6
3: 36
4: 336
1106809841_1106809846 6 Left 1106809841 13:33349479-33349501 CCTTGGCCCTACAGAAAGAGGGC 0: 1
1: 0
2: 0
3: 8
4: 158
Right 1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG 0: 1
1: 0
2: 6
3: 36
4: 336
1106809842_1106809846 0 Left 1106809842 13:33349485-33349507 CCCTACAGAAAGAGGGCTCCATG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG 0: 1
1: 0
2: 6
3: 36
4: 336
1106809838_1106809846 15 Left 1106809838 13:33349470-33349492 CCACTGCATCCTTGGCCCTACAG 0: 1
1: 0
2: 1
3: 23
4: 230
Right 1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG 0: 1
1: 0
2: 6
3: 36
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106809846 Original CRISPR GAGCATGCACAGAAGCAGCA AGG Intronic
900251367 1:1671906-1671928 GAGCGTTCACAGAATCAGGAAGG - Intronic
901658109 1:10782208-10782230 AAGCATTCCCAGAAGCTGCAGGG - Intronic
904093096 1:27958807-27958829 GAGCGTGCACAGGCCCAGCAGGG - Exonic
905023003 1:34830753-34830775 GAGCATGCCCAGATGAACCAAGG + Intronic
905265470 1:36751483-36751505 CAGCATCCTCACAAGCAGCATGG - Intergenic
905357492 1:37394944-37394966 GAGAAAGCACAGAAGCAGCAAGG + Intergenic
906059175 1:42937128-42937150 GAGCAAGCACAGTGGGAGCAGGG - Intronic
907346164 1:53782566-53782588 GAAACTGTACAGAAGCAGCAAGG + Intronic
907811516 1:57875311-57875333 GAGCATGTTCAAAGGCAGCAAGG - Intronic
908268991 1:62404709-62404731 GAGCCTGCACACAGGCAGTAAGG - Intergenic
909757875 1:79249891-79249913 GAGCATGCCCAGAAGTAGGCTGG + Intergenic
910148946 1:84117965-84117987 AAGCATGAACAGCTGCAGCAAGG - Intronic
911581487 1:99638727-99638749 GAGCACACACAGAAGCAACCTGG + Intergenic
911709836 1:101057827-101057849 CAGAATGCAAAGAGGCAGCAAGG - Intergenic
911779805 1:101861917-101861939 GAGATTGCACAGCAGAAGCATGG + Intronic
915032009 1:152887607-152887629 GAGCATACAAATAATCAGCAGGG - Intergenic
915307531 1:154989270-154989292 GGGCCTGCAAGGAAGCAGCATGG + Intronic
916211781 1:162365591-162365613 GAGCCTTCACAGAGGAAGCAGGG - Intronic
917154230 1:171978760-171978782 GAGCAGGCTTAGAAGTAGCATGG + Intronic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
919378609 1:196825627-196825649 TAACATGCACAGAAGAAGGATGG + Exonic
919390807 1:196983035-196983057 TAACATGCACAGAAGAAGGATGG + Exonic
920260464 1:204685026-204685048 GAGAATGCCCAGAAGCGGCCAGG - Intronic
920928266 1:210363305-210363327 CAGCATGCTCTGCAGCAGCATGG - Intronic
921034794 1:211366665-211366687 GAGCTTGCACTGAAGCAGGGAGG + Intronic
922470662 1:225875166-225875188 GAGCATGCATGCAGGCAGCAAGG + Intronic
923125095 1:231027781-231027803 GAGCATTCACAGATGCAGTGGGG - Intronic
924150636 1:241125740-241125762 GACCCTGTACAGAAGCAGCCTGG + Intronic
1063732879 10:8719773-8719795 GGGCATCCACAGCAGCAGTAAGG + Intergenic
1065010735 10:21418571-21418593 GAGGACGGACAGAAGGAGCAAGG - Intergenic
1065251701 10:23821977-23821999 TAGCCTGAACACAAGCAGCAGGG - Intronic
1065724210 10:28654554-28654576 GGGCATGGACAGGAGCACCAGGG - Intergenic
1066961340 10:42230621-42230643 GAGGATCCAGAGAAACAGCAGGG + Intergenic
1067174468 10:43933842-43933864 TGGCAAGCACAGAAGCAGCAAGG + Intergenic
1067551444 10:47239210-47239232 GTGCATGCACAGGAGAGGCAAGG - Intergenic
1068106502 10:52623536-52623558 GAACATGCAGAGAAATAGCAAGG + Intergenic
1068657261 10:59588498-59588520 GACCATGCACAGAGTCAGCAGGG + Intergenic
1068755580 10:60648853-60648875 GAGCAGGAGCAGAAGCAGCTTGG - Intronic
1069032924 10:63617123-63617145 CAGCATGCACAGAGGCAGTGAGG - Intronic
1069778605 10:70941108-70941130 AAGGAAGCACAGAGGCAGCAGGG + Intergenic
1072639451 10:97200489-97200511 GATAAGGCACAGAAGGAGCACGG - Intronic
1073939836 10:108683978-108684000 GAGCAGGCACAGAAGGTGTAAGG - Intergenic
1074062340 10:109978348-109978370 GAGCATGCACAGAAACAGACTGG + Intergenic
1074113377 10:110438115-110438137 GAGCAGGCGCAGCAGCACCAGGG - Intergenic
1074945645 10:118278296-118278318 GAGCAGGGCCAGAATCAGCAGGG + Intergenic
1077261128 11:1621642-1621664 CAGCCTGAAGAGAAGCAGCAGGG + Exonic
1078465208 11:11545236-11545258 GCGCATTCAAAGAAGCAGCATGG - Intronic
1078655683 11:13236649-13236671 GAGGAGCCACAGAGGCAGCATGG + Intergenic
1078937599 11:15965332-15965354 GAGAATGAAAAGAAACAGCAGGG - Intergenic
1079105988 11:17572763-17572785 GAGAAAGCTAAGAAGCAGCATGG - Intronic
1080174354 11:29343886-29343908 GCGTATGCACAGAGGCAGCCTGG - Intergenic
1080646440 11:34191605-34191627 GAGCATCAAGACAAGCAGCATGG + Intronic
1080690402 11:34552565-34552587 CATCCTGCACAGAAGCAGAAAGG + Intergenic
1080752400 11:35162839-35162861 GAGCATGCACATAAGAAGCAGGG - Intronic
1082739821 11:56898381-56898403 GGGCATGTAGAGAAGCAGAATGG + Intergenic
1084209379 11:67614048-67614070 GAGCCTGTTCAGAAGCACCAGGG - Intergenic
1084716558 11:70878006-70878028 AAGAATGCAGAGAAGCAGGAGGG + Intronic
1084982936 11:72841635-72841657 GAGCAGTCAGAGAAGCAGCCAGG - Intronic
1087083812 11:94197044-94197066 GTACATTCACAGAAGCAACAAGG + Intergenic
1087440510 11:98177597-98177619 GAGGATGGACAGACGCTGCATGG + Intergenic
1088831285 11:113539102-113539124 GAGGGGGCACAGAAGCAGCCTGG + Intergenic
1089049916 11:115537078-115537100 GACCAGGTACAGAAGCAGCAAGG - Intergenic
1089592839 11:119555713-119555735 AGGCAGGCACAGAACCAGCAGGG - Intergenic
1090896496 11:130980684-130980706 CAGCATGAACAGCAGCAGCAGGG + Intergenic
1094039146 12:26104678-26104700 GAGCATGCACAGCACAACCAAGG - Intergenic
1094800261 12:34024845-34024867 GAGGATACAGAGAAGGAGCAGGG + Intronic
1096422737 12:51474225-51474247 AAGTATGCAAAGAAGCAGCAAGG + Intronic
1096743985 12:53713665-53713687 GAGCCTGTGCAGAAGCAGTAAGG - Intronic
1099032832 12:77549579-77549601 GTTCATGGACAGATGCAGCAGGG + Intergenic
1099070153 12:78036219-78036241 CAGCATCCACTGCAGCAGCAAGG + Intronic
1100164095 12:91896428-91896450 GAGCATTCACATAAGCAGAATGG + Intergenic
1102346360 12:112163605-112163627 GAGCATGGTCAGCAGCTGCAGGG + Exonic
1102468303 12:113143303-113143325 GAGCATGCACAGGGGCAGGGAGG - Intergenic
1105556403 13:21450278-21450300 GAGCGGGCAGAGAAGCAGCCAGG + Intronic
1105783629 13:23725926-23725948 GAGCCTGCACAGCAGGAGCGGGG + Intergenic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1106415265 13:29541007-29541029 GAGTGTGCACAGAAGGGGCAGGG + Intronic
1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG + Intronic
1107343418 13:39434087-39434109 TTGCATGCTCAGAGGCAGCATGG + Intronic
1107553686 13:41499353-41499375 GAGAAGGCACAGAACCAGCTTGG - Intergenic
1107823077 13:44303934-44303956 GGGCCTGCCAAGAAGCAGCAGGG + Intergenic
1108707272 13:53000959-53000981 GAGCAGGCACAGAGGCATCCAGG + Intergenic
1108727582 13:53200039-53200061 CAGCAGCCACAGAATCAGCAAGG - Intergenic
1109954114 13:69543243-69543265 AAGCATGCTCAGAAGTAGCAGGG - Intergenic
1111299685 13:86331736-86331758 GAGAATCCTTAGAAGCAGCAAGG - Intergenic
1112267588 13:97939314-97939336 CTGCATGCACAGATGCACCAGGG - Intergenic
1113063308 13:106348806-106348828 GCGAATGCAGAGAAACAGCAGGG - Intergenic
1113576627 13:111399659-111399681 GTGCCTGCACAGAGGAAGCAGGG - Intergenic
1113633031 13:111900784-111900806 GAGCAGACACAGCCGCAGCAAGG + Intergenic
1114416807 14:22550399-22550421 GGATATGCACAGAAGCTGCAAGG + Intergenic
1115303709 14:31913410-31913432 GACCAGGTACAGCAGCAGCAGGG + Intergenic
1116749851 14:48869480-48869502 GAAAATTCAAAGAAGCAGCAGGG + Intergenic
1118857105 14:69632222-69632244 GACCAGGGAGAGAAGCAGCAGGG - Intronic
1119485047 14:74981532-74981554 GAGCAGGCGCAGAGGCAGCCAGG - Intergenic
1120459991 14:84782733-84782755 GAGCATCCACAGTAGCAGCATGG + Intergenic
1120891497 14:89495915-89495937 GAGCATGCTTAGGAGCAGCACGG - Intronic
1122158356 14:99764698-99764720 GCCCAGGCACAGAAGCAGCAGGG + Intronic
1123132515 14:105999863-105999885 GGGCATGCTCAGAACCACCAGGG - Intergenic
1123132576 14:106000142-106000164 GAGGGTGCTCAGAAGCACCAGGG - Intergenic
1123582689 15:21730821-21730843 GGGCATGCTCAGAACCACCAGGG - Intergenic
1123582756 15:21731119-21731141 GAGGGTGCTCAGAAGCACCAGGG - Intergenic
1123619339 15:22173417-22173439 GGGCATGCTCAGAACCACCAGGG - Intergenic
1123619406 15:22173715-22173737 GAGGGTGCTCAGAAGCACCAGGG - Intergenic
1125518450 15:40335642-40335664 GAGCAAGCCCAGAAGCAGAGCGG - Exonic
1125541303 15:40471326-40471348 CAGCATGGACGGCAGCAGCAGGG - Exonic
1125589339 15:40844616-40844638 GAGCGTGCACAGAAGCCACAAGG - Exonic
1125688603 15:41578642-41578664 ATGCATGCACTTAAGCAGCAGGG - Exonic
1128360682 15:66959466-66959488 GAGCAGGGACAGGAGGAGCAAGG + Intergenic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1131671831 15:94627947-94627969 GGGCATGCACAGAAGAAAGAGGG - Intergenic
1132212705 15:100036206-100036228 GAGGGTGCAGAGAGGCAGCAAGG + Intronic
1134235599 16:12463074-12463096 CAGCATGGGCAGCAGCAGCAGGG - Intronic
1135569108 16:23534832-23534854 GAGCATGGCCAGGAGGAGCAGGG - Intronic
1135741494 16:24979261-24979283 GAGCAGGCACAGAATCACCAAGG + Intronic
1135838088 16:25846188-25846210 AAGCATTCCCAGAAGCTGCAAGG + Intronic
1137251335 16:46743081-46743103 GAGGAAGCACAGAAACGGCAGGG - Intronic
1137310452 16:47251579-47251601 GAACATGCACAGGAACAGGAGGG + Intronic
1137648144 16:50093824-50093846 GAGCATGCACACATGCGTCAGGG + Intronic
1138874725 16:60936128-60936150 GAGCATGAGCTGAAGTAGCAAGG + Intergenic
1141151418 16:81567124-81567146 GAGCATCCACAGAAACTGTATGG - Intronic
1141326308 16:83062873-83062895 GTGCATGCAAAGAATCACCAAGG - Intronic
1142491119 17:280379-280401 AAGCAAGCCCAGCAGCAGCAGGG + Intronic
1142767102 17:2071069-2071091 GAGCAGGGACAGAACAAGCATGG + Intronic
1142898961 17:3000630-3000652 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142898980 17:3000729-3000751 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142899021 17:3000927-3000949 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142899039 17:3001026-3001048 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142899078 17:3001224-3001246 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142899097 17:3001323-3001345 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142899115 17:3001422-3001444 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1142899133 17:3001521-3001543 GAGAAGGGACAGAAGAAGCAGGG + Intronic
1143248601 17:5505507-5505529 GAGCATGCATAGGGGCAGGAAGG - Intronic
1143330337 17:6130281-6130303 GAGAATGCAGAGACACAGCAAGG + Intergenic
1144586184 17:16489299-16489321 GAGCAGGCACAGAACCAGGGAGG - Intronic
1147182067 17:38692771-38692793 GAGCATGCCAGGAAACAGCAAGG + Intergenic
1147240036 17:39084800-39084822 GGCCAGGCACAGGAGCAGCAGGG + Intronic
1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG + Exonic
1148172531 17:45534681-45534703 GAGCAACAACAGAAGAAGCAAGG + Intergenic
1148276739 17:46310769-46310791 GAGCAACAACAGAAGAAGCAAGG - Intronic
1148298856 17:46528357-46528379 GAGCAACAACAGAAGAAGCAAGG - Intronic
1149461180 17:56831503-56831525 GAGCAATCACAGCATCAGCAAGG + Intronic
1150403735 17:64881606-64881628 GAGCAACAACAGAAGAAGCAAGG + Intronic
1150866526 17:68856391-68856413 GAGTATACACTTAAGCAGCATGG + Intergenic
1151304019 17:73251340-73251362 AAGCCTGCTCAGAACCAGCAGGG + Intronic
1152330930 17:79672654-79672676 CACCATGCTCAGAGGCAGCAAGG - Intergenic
1152760794 17:82106083-82106105 GGGCAGGCTCAGCAGCAGCAGGG - Intronic
1153152907 18:2114921-2114943 GCACATGCACAGCAGCAGCATGG + Intergenic
1153287125 18:3467099-3467121 GAGCAAGCATAGAAACAGGAAGG - Intergenic
1154019457 18:10650159-10650181 GAGCATGAACCGAAGCAGAGTGG + Intergenic
1155275956 18:24187761-24187783 GAGAAGCTACAGAAGCAGCATGG + Intronic
1155744846 18:29342052-29342074 GAGCAAGCATAGAAGCAGATAGG - Intergenic
1158546600 18:58403137-58403159 GAGGAGGCACATGAGCAGCACGG - Intergenic
1158668880 18:59456818-59456840 GAGCAGGCCCAGAGGCAGCCTGG + Intronic
1158820525 18:61153473-61153495 GAGAATTCACAGCATCAGCATGG + Intergenic
1159306345 18:66647817-66647839 GATCATGCACAGAAACAATATGG - Intergenic
1160288032 18:77564745-77564767 GAGCCTGCAATGAAGCAGCGAGG + Intergenic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1161503862 19:4633404-4633426 GAGAATGCACTGAAGAGGCAGGG + Intergenic
1162030424 19:7914867-7914889 GAGCAGGGCCAGCAGCAGCACGG - Intergenic
1162834412 19:13306898-13306920 GACCAAGCAGAGAAGCAACAGGG - Intronic
1163686347 19:18714026-18714048 TAGCGTGCCCGGAAGCAGCAGGG + Intronic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1164850940 19:31483620-31483642 GAGGCTGCACAGGAGCAGCAGGG + Intergenic
1165945547 19:39439697-39439719 GATGATCCACAGAAGCAACATGG - Intronic
1166886377 19:45963475-45963497 GAGCATGCACAAAAGCCCTAAGG - Intronic
1167824683 19:51961452-51961474 GAGCATGCACAGAGGCCTGAAGG + Intergenic
925507352 2:4583346-4583368 GAGGAAGCACAGAACCAGAAAGG + Intergenic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
926724141 2:15984404-15984426 GAGCATCCAGAAATGCAGCATGG - Intergenic
929971360 2:46580034-46580056 GGGCATAGACAGAAGCAGAAAGG - Intronic
930191879 2:48467955-48467977 CATGATGCACAGAAGAAGCAGGG - Intronic
930611201 2:53545917-53545939 GCACATGAACAGAAGCAGCCAGG + Intronic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
932126826 2:69152194-69152216 GAGCAGGAACAGGATCAGCAGGG - Exonic
932426255 2:71637339-71637361 GAGCACCCACAGGAGCAGAAGGG + Intronic
933515098 2:83290441-83290463 TAGCAGGTACAGAAGCATCAGGG + Intergenic
934301693 2:91780451-91780473 GAGCTGGCACACCAGCAGCATGG + Intergenic
934323580 2:91986472-91986494 GAGGATCCAGAGAAACAGCAGGG - Intergenic
934339423 2:92240811-92240833 AAGCATTCTCAGAAGCATCATGG + Intergenic
934354771 2:92483674-92483696 AAGCATTCTCAGAAGCATCATGG + Intergenic
934375412 2:92813806-92813828 AAGCATTCTCAGAAGCATCATGG + Intergenic
934386085 2:92985104-92985126 AAGCATTCTCAGAAGCATCATGG + Intergenic
934394699 2:93124487-93124509 AAGCATTCTCAGAAGCATCATGG + Intergenic
934413732 2:93431061-93431083 AAGCATTCTCAGAAGCATCATGG + Intergenic
934422748 2:93576086-93576108 AAGCATTCTCAGAAGCATCATGG + Intergenic
934425606 2:93621994-93622016 AAGCATTCTCAGAAGCATCATGG + Intergenic
934428210 2:93663596-93663618 AAGCATTCTCAGAAGCATCATGG + Intergenic
934430265 2:93696502-93696524 AAGCATTCTCAGAAGCATCATGG + Intergenic
934431213 2:93711935-93711957 AAGCATTCTCAGAAGCATCATGG + Intergenic
934432562 2:93734005-93734027 AAGCATTCTCAGAAGCATCATGG + Intergenic
934433485 2:93748944-93748966 AAGCATTCTCAGAAGCATCATGG + Intergenic
934436836 2:93803100-93803122 AAGCATTCTCAGAAGCATCATGG + Intergenic
934437753 2:93817892-93817914 AAGCATTCTCAGAAGCATCATGG + Intergenic
934438599 2:93831637-93831659 TAGCATTCTCAGAAGCATCATGG + Intergenic
934449675 2:94010441-94010463 AAGCATTCTCAGAAGCATCATGG + Intergenic
934451450 2:94039294-94039316 TAGCATTCTCAGAAGCATCATGG + Intergenic
935291826 2:101617583-101617605 GGGCAGGCTCAGAGGCAGCATGG + Intergenic
937188280 2:120067277-120067299 GAGAATGGAGAGAAGCAGCTAGG + Intronic
937644503 2:124251122-124251144 GAGCAGCCACAGCAGCAGAACGG - Intronic
937961877 2:127466335-127466357 GAGCAAGAATAGAAGTAGCAAGG - Intronic
938900990 2:135798313-135798335 GAGCAAGCACAGACCCAGCTGGG - Intronic
939146761 2:138425025-138425047 AAGCAGGCTCAGAAGCAGCTGGG + Intergenic
940105063 2:150090130-150090152 GTGAGAGCACAGAAGCAGCAAGG - Intergenic
940113227 2:150178614-150178636 GAGCAAGCAAAGAGGCAGAAAGG + Intergenic
940742819 2:157530398-157530420 GAGTCTGCACAAAAGCACCAGGG - Exonic
941400358 2:165022747-165022769 GACCATGCAGGGAAGCACCAGGG + Intergenic
941779389 2:169427527-169427549 GTGCCTGAACAGAAGCATCAGGG + Intergenic
942103322 2:172607719-172607741 GAACAGGCTCAGCAGCAGCAAGG + Intronic
942209125 2:173652920-173652942 GAGCAAGCACAGAAGGGGTACGG - Intergenic
943581626 2:189690789-189690811 GAGCATGTATAGAAGTAGGAGGG + Intronic
944972524 2:205010322-205010344 GTTCATGCACAGAGGCTGCAAGG - Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
946445614 2:219737592-219737614 GACCCAGCACAGAACCAGCAGGG - Intergenic
948122775 2:235543476-235543498 GAGCATCCAGAGAAGAAGCTGGG + Intronic
948603341 2:239119855-239119877 GCGACTGCACAGAGGCAGCAGGG + Intronic
949077917 2:242073199-242073221 GAGCATGCCCAGATGCTCCAGGG + Intergenic
1169038116 20:2470333-2470355 GAGCAGGCACTGGAGCCGCAGGG - Intronic
1169209005 20:3755326-3755348 GAGCTTGCACTGTGGCAGCATGG - Intronic
1172909127 20:38393496-38393518 GAGCATGCACAGAAGCGCAGTGG - Intergenic
1174372177 20:50098417-50098439 GAGCAAGGGCAGAAGCAGCTAGG + Intronic
1174718180 20:52782973-52782995 AAGAAAACACAGAAGCAGCAGGG - Intergenic
1176241921 20:64079364-64079386 GGGCGTGCACTGCAGCAGCAGGG + Exonic
1177457454 21:21359318-21359340 CAGCAAGCTCAGAAGCATCAAGG - Intronic
1178135264 21:29619774-29619796 AAGCAGCAACAGAAGCAGCATGG + Intronic
1178940647 21:36902352-36902374 GACCTAGCACAGAAGCAGAAAGG + Intronic
1179045616 21:37842641-37842663 CAACATGCAGAGAAACAGCATGG + Intronic
1179407298 21:41136561-41136583 GAGCATGCACACACCCAGCTGGG - Intergenic
1179794042 21:43772088-43772110 GAGCATCAACAGCAGCAGCTTGG - Intergenic
1179797100 21:43791452-43791474 GAGCAGGTACAGAAGCAGCGGGG + Intronic
1180723395 22:17926388-17926410 GAGCATGCACAGAGAAACCAGGG - Intronic
1182651373 22:31853981-31854003 CAGCCTACACAGAAGCAGGAAGG - Intronic
1183032070 22:35113841-35113863 GAGGAAGCACAGAAGGACCAGGG - Intergenic
1183749258 22:39710428-39710450 AAGCTTGCCCAGAACCAGCAGGG + Intergenic
1184258520 22:43301255-43301277 GAGGATGGACAGAGGCAGGATGG - Intronic
1184962881 22:47944370-47944392 GGGCACGCAGAAAAGCAGCAAGG - Intergenic
950454611 3:13085257-13085279 GAGCAGCCCCAGTAGCAGCAAGG + Intergenic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951718533 3:25674138-25674160 GAGCATGCACACACCCAGCCAGG + Intergenic
952237448 3:31494587-31494609 GGGAATGCAGAGAAGCACCACGG - Intergenic
953267366 3:41404722-41404744 GCACATGCACATATGCAGCAGGG - Intronic
953447524 3:42980467-42980489 GAGCAGGCACGGAAGCAGCCAGG - Intronic
955966410 3:64393483-64393505 TAGCATGGACAGGAGGAGCAAGG + Intronic
956969701 3:74508262-74508284 CAGAAGGCAAAGAAGCAGCAAGG - Intronic
960687417 3:120307920-120307942 GAGCAGGAGCAGCAGCAGCAAGG + Intergenic
961531620 3:127543724-127543746 GGGCAGGAGCAGAAGCAGCAAGG + Intergenic
962481249 3:135800528-135800550 GAGCAAGCACTAAAGCAGCAAGG - Intergenic
962646841 3:137448560-137448582 GAGCATGCACTGCAGCACCATGG + Intergenic
963445757 3:145405577-145405599 GAGAAAGCATAGCAGCAGCATGG - Intergenic
964469035 3:157031914-157031936 GGGCATCCCCAGAAACAGCAAGG + Intronic
964720301 3:159763622-159763644 GAGCATGCCCAGAGGCTGCCGGG - Intronic
964927897 3:161979251-161979273 GAGCATGCACACACCCAGCCAGG + Intergenic
968810614 4:2798117-2798139 GACCAGGCCCAGAAGCAGCTGGG - Intronic
968874229 4:3256858-3256880 GAGCAAGCCCAGGAGCAGCTAGG + Intronic
969892181 4:10270061-10270083 CAGCATGGCCAGCAGCAGCATGG + Intergenic
970222023 4:13821315-13821337 GGCCATGCAGGGAAGCAGCAGGG - Intergenic
975892492 4:79046340-79046362 CAGCAGGCACAGAAGCAGAAGGG - Intergenic
976070494 4:81234679-81234701 CACCATGCAAAGAAGAAGCAAGG - Intergenic
977079634 4:92508576-92508598 GAGCAGGCACAAAAGCCGGAAGG + Intronic
977411559 4:96672509-96672531 GGGCATGGGCAGAAGCAGCTGGG + Intergenic
977421413 4:96804726-96804748 GAGCATGCAGAGAGACAGAAGGG - Intergenic
979137255 4:117125275-117125297 CAGCATGTACAGTATCAGCAGGG - Intergenic
979268028 4:118726031-118726053 GAGAAGGCACACAAGAAGCAAGG - Intronic
979403910 4:120285379-120285401 GAGCATGGAGAGAAGCAGGGAGG + Intergenic
982250070 4:153396302-153396324 CAGCACGCTCAGAAGCAGCACGG - Intronic
982768287 4:159372460-159372482 GAGCATGCAGAGAACTGGCATGG + Intergenic
983064763 4:163195443-163195465 GCACATGCAGATAAGCAGCACGG - Intergenic
984080361 4:175241202-175241224 CAGCATTCACAGAAGAAGCAGGG + Intergenic
986778472 5:11042135-11042157 GAACAAGAACAGTAGCAGCAGGG - Intronic
987851579 5:23361995-23362017 GAGCATGCATAGAAACATCTGGG - Intergenic
988197058 5:28017325-28017347 GAGCAAGCAAGCAAGCAGCAGGG + Intergenic
989358429 5:40571519-40571541 GGGGATGCAGAGAAGCAGAAGGG + Intergenic
989385616 5:40852211-40852233 GAACATGGATAGAAGCAGAAAGG + Exonic
990982986 5:61618315-61618337 GAGCATGCACACAGTGAGCATGG + Intergenic
991409614 5:66333196-66333218 TTGCAGGCACAAAAGCAGCAAGG - Intergenic
997093706 5:130886477-130886499 GAGCATGAGCAGCAGCACCAGGG - Intergenic
998368222 5:141644674-141644696 GAGCAGGCTCGGAACCAGCACGG - Exonic
998556038 5:143124636-143124658 GGGCAAACACAGAAGCAGCAAGG + Intronic
1000281201 5:159783878-159783900 GAGCATGCACACAGGAAGCATGG + Intergenic
1000370060 5:160526837-160526859 GAGCCTGTACAGCATCAGCAGGG - Intergenic
1001187638 5:169590808-169590830 GACAAGGCACAGAAGCAGTAAGG + Intronic
1002672110 5:180875891-180875913 GAGGATGGACAGAAGCATCTGGG + Intergenic
1004469231 6:15914154-15914176 GTGCATACCCAGAAGCAGAATGG - Intergenic
1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG + Intronic
1006016538 6:31085754-31085776 GAGCATGCACGACAGCAGCGAGG - Intergenic
1006154233 6:32005687-32005709 CAGCAGGCCCAGGAGCAGCATGG - Intergenic
1006160537 6:32038421-32038443 CAGCAGGCCCAGGAGCAGCATGG - Exonic
1006370173 6:33639426-33639448 GAGGAGGTACAGAAGGAGCACGG + Intronic
1007314786 6:40978754-40978776 GTGCATGCTCAGCTGCAGCAGGG + Intergenic
1008172098 6:48220544-48220566 GAGCAGCGACAGTAGCAGCAAGG - Intergenic
1008956596 6:57222311-57222333 GAGCATGCGCAGACGAAGCACGG - Exonic
1008958859 6:57245235-57245257 GAGCATGCTCAACAGCAGCATGG - Intergenic
1011010220 6:82695241-82695263 GACCATTCACAGAGGCTGCAAGG + Intergenic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1012815630 6:104018769-104018791 CAGCAGTCAGAGAAGCAGCATGG - Intergenic
1013974719 6:116064164-116064186 GAGGATGCAGAGGTGCAGCAGGG - Intergenic
1015593753 6:134846426-134846448 CAGCATGCACAAAAGCCTCATGG + Intergenic
1015979541 6:138825229-138825251 GAGCAGGCAAAGAAGAACCAAGG - Intronic
1016914193 6:149229594-149229616 GATCCTGCACAGAGTCAGCAGGG + Intronic
1017082379 6:150682120-150682142 CACCATGCACAGAGGCTGCATGG - Intronic
1017662358 6:156687224-156687246 GAGCGGGCACAGACGCAGCCGGG + Intergenic
1018622664 6:165746609-165746631 GCGCGTGCACAGAAGCACCCAGG - Intronic
1019957231 7:4424995-4425017 GAGCATGCCCAGATGAACCAAGG - Intergenic
1021270101 7:18574739-18574761 GAGCATGCACATACCCAGCCGGG + Intronic
1021480321 7:21108161-21108183 GAGCATGCGCAGCAGCTGGAAGG - Intergenic
1021915105 7:25423609-25423631 GAGCAAGAAGAGCAGCAGCAAGG - Intergenic
1023210749 7:37802488-37802510 CAGCAGGCACAAAATCAGCAAGG - Intronic
1023862129 7:44223075-44223097 AAACATGCACATAAGCAGGACGG + Intronic
1024563573 7:50664036-50664058 GAGCATGGCCAGCAGGAGCATGG - Intronic
1024570684 7:50720915-50720937 GAGCAATCACAGAAGCTGCACGG + Intronic
1024586171 7:50843925-50843947 GAGCATGGTCAGAAGCAAGAAGG + Intergenic
1028210542 7:88069071-88069093 GAGCACACACAGAAGCAAGAGGG - Intronic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1030149042 7:106384438-106384460 GAGCCTTCAAAGGAGCAGCATGG + Intergenic
1030712500 7:112767078-112767100 GAGCAGCTACAGAAGTAGCAAGG + Exonic
1031922037 7:127609239-127609261 GAGCATGCACACACCCAGCCAGG + Intergenic
1031971850 7:128070322-128070344 GTGCATGTACACAAGCAGCATGG - Intronic
1032554395 7:132816654-132816676 GAGGAGGCACAGCAGCAGCTGGG - Intronic
1032653749 7:133905951-133905973 GAGCAAGCAGTGGAGCAGCATGG + Intronic
1033761168 7:144438258-144438280 GAGCATGTAAAGAAGTAGAATGG + Intergenic
1033813569 7:145046173-145046195 GAGAATGCACAGCTGGAGCATGG + Intergenic
1034258173 7:149735833-149735855 GTGCTTGCACAGAATCAGGAAGG + Intergenic
1034410985 7:150942129-150942151 GAGCAGGAACAGAAGCAGGAGGG - Intergenic
1034658817 7:152751351-152751373 GAGCAGGCACAGATGCAGGGAGG - Intergenic
1035211542 7:157332326-157332348 CAGCAAGCACAGAGGCTGCAGGG - Intergenic
1035536455 8:395000-395022 GAGCATGCCCAGATGCTCCAGGG + Intergenic
1035863721 8:3058920-3058942 GTGCATTCAGAGAAGCAGCAAGG - Intronic
1036687731 8:10923106-10923128 GGGCACCCACAGAAGCAGGAGGG - Intronic
1036741131 8:11362566-11362588 GTGCATTCCCACAAGCAGCACGG - Intergenic
1038422747 8:27443842-27443864 GGGCATTCACAGAAGCTGCATGG - Intronic
1043163406 8:76873553-76873575 CAGCATGCAAAGGAGAAGCATGG + Intergenic
1043163555 8:76875072-76875094 GAGCAGGCACTGAAGTATCAAGG - Intergenic
1043261709 8:78208373-78208395 GAGTAAAAACAGAAGCAGCATGG + Intergenic
1044312458 8:90709335-90709357 GAGGATGAACAGAAGCAGAGTGG - Intronic
1044844433 8:96366421-96366443 GAGCATGCCCAGATGAACCAAGG + Intergenic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1046883893 8:119341133-119341155 GAGCTTCCACAGCAGCATCATGG - Intergenic
1049204406 8:141356924-141356946 CAGCATGCACAGGAGCTCCAAGG - Exonic
1049499386 8:142953442-142953464 GAGCCTGGGCAGAGGCAGCAGGG - Intergenic
1052020962 9:23524766-23524788 GAGCAAGCATAGAAGCAGAGAGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053416403 9:37949584-37949606 CAGCATGGACAGAAGCAGCAAGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG + Intergenic
1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG + Intergenic
1053895295 9:42736523-42736545 AAGCATGCACACATGCAGCTGGG - Intergenic
1054234327 9:62543557-62543579 AAGCATGCACACATGCAGCTGGG - Intergenic
1054264947 9:62908613-62908635 AAGCATGCACACATGCAGCTGGG - Intergenic
1054733983 9:68732030-68732052 GAGCCTCCACCGAAGCACCATGG + Intronic
1055357028 9:75448205-75448227 GAGCATGCAGACAAGTAGTAGGG - Intergenic
1056409761 9:86313343-86313365 GGGAATACACAGAAGAAGCAAGG + Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058315057 9:103554593-103554615 GGGCATTCACAGAAGTGGCAGGG - Intergenic
1058736129 9:107895849-107895871 GTGCATGCACAGACTCAACAAGG - Intergenic
1059672591 9:116505809-116505831 GAGCATCCTCAGGAGCACCAAGG - Intronic
1060053601 9:120394085-120394107 GAGCATGGACAGAGGCACAAAGG - Intronic
1060315078 9:122502167-122502189 CAGAATGCACTGAAGCAGTAAGG + Intergenic
1060430083 9:123543576-123543598 GAGCAGGGACAGAAGGAGCGTGG - Intronic
1062358559 9:136176762-136176784 GACCCAGAACAGAAGCAGCAGGG - Intergenic
1062358571 9:136176808-136176830 GACCCAGAACAGAAGCAGCAGGG - Intergenic
1186084072 X:5967561-5967583 GTTCATGCACAGAAGCAGAAAGG - Intronic
1187144067 X:16621495-16621517 GAGCATGTGGAGAAGCAGGATGG + Intronic
1189081293 X:37975368-37975390 CAGCATGTACTGGAGCAGCAGGG + Intronic
1189534806 X:41924488-41924510 GTGCAGGCACAGGAGCAGCCAGG + Intergenic
1189905885 X:45759026-45759048 GAGGATGTACAGAAGCCCCAGGG - Intergenic
1190335509 X:49259383-49259405 GATCATGCACGGATCCAGCATGG + Intronic
1191038833 X:56057287-56057309 TGGCAAGCACAGAATCAGCAAGG - Intergenic
1192165804 X:68827030-68827052 GTGCATGGACAGCAGCAGCCTGG - Intergenic
1192354944 X:70393480-70393502 GAGTATGCAGAAAATCAGCAAGG - Intronic
1193736203 X:85159752-85159774 GGGCATTCACAGAGGCAGCATGG - Intergenic
1195114979 X:101688224-101688246 GAGCAGGCACAGCAGCAGCAGGG - Intergenic
1195767989 X:108317042-108317064 GGGCAAGCACAGAAGCAGAAAGG + Intronic
1195981988 X:110588949-110588971 TAAAATGCACAGAAGCATCAAGG + Intergenic
1196376557 X:115039700-115039722 GAGTGACCACAGAAGCAGCATGG + Intergenic
1197828047 X:130611976-130611998 TAGAATGCCAAGAAGCAGCATGG - Intergenic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1199145945 X:144367367-144367389 CAGCATACAGAAAAGCAGCATGG - Intergenic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic