ID: 1106814282

View in Genome Browser
Species Human (GRCh38)
Location 13:33389338-33389360
Sequence CTAATTGAACAGTTTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106814275_1106814282 25 Left 1106814275 13:33389290-33389312 CCAGTACATAAGGTATGTGAAAC No data
Right 1106814282 13:33389338-33389360 CTAATTGAACAGTTTGAGGAGGG No data
1106814274_1106814282 26 Left 1106814274 13:33389289-33389311 CCCAGTACATAAGGTATGTGAAA No data
Right 1106814282 13:33389338-33389360 CTAATTGAACAGTTTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106814282 Original CRISPR CTAATTGAACAGTTTGAGGA GGG Intergenic
No off target data available for this crispr