ID: 1106814522

View in Genome Browser
Species Human (GRCh38)
Location 13:33392481-33392503
Sequence CACTTGAATCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106814522_1106814528 17 Left 1106814522 13:33392481-33392503 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1106814528 13:33392521-33392543 TCCCAAGTAGCTGGGACTACAGG 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
1106814522_1106814525 8 Left 1106814522 13:33392481-33392503 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1106814525 13:33392512-33392534 GCCTCAGTCTCCCAAGTAGCTGG 0: 3291
1: 90134
2: 199622
3: 238811
4: 230148
1106814522_1106814527 9 Left 1106814522 13:33392481-33392503 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1106814527 13:33392513-33392535 CCTCAGTCTCCCAAGTAGCTGGG 0: 3992
1: 102915
2: 212635
3: 250751
4: 264126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106814522 Original CRISPR CACTTGAATCCAGGAGACGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr