ID: 1106820276

View in Genome Browser
Species Human (GRCh38)
Location 13:33456739-33456761
Sequence CTGTATTCCCACATAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106820276_1106820282 10 Left 1106820276 13:33456739-33456761 CCTTCCACTATGTGGGAATACAG No data
Right 1106820282 13:33456772-33456794 CCATCTATGAACCAGAAAGCAGG 0: 28
1: 155
2: 410
3: 657
4: 1013

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106820276 Original CRISPR CTGTATTCCCACATAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr