ID: 1106821326

View in Genome Browser
Species Human (GRCh38)
Location 13:33467814-33467836
Sequence TCATCCCCAGGTTTGCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106821324_1106821326 14 Left 1106821324 13:33467777-33467799 CCACTTTATAGATGGTATATATA No data
Right 1106821326 13:33467814-33467836 TCATCCCCAGGTTTGCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106821326 Original CRISPR TCATCCCCAGGTTTGCTTTA AGG Intergenic
No off target data available for this crispr