ID: 1106821752

View in Genome Browser
Species Human (GRCh38)
Location 13:33472573-33472595
Sequence TGTTCCCTAGAGCAGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106821747_1106821752 26 Left 1106821747 13:33472524-33472546 CCTCAGTTGCGAGTTGTCACATG No data
Right 1106821752 13:33472573-33472595 TGTTCCCTAGAGCAGGTAGAGGG No data
1106821746_1106821752 27 Left 1106821746 13:33472523-33472545 CCCTCAGTTGCGAGTTGTCACAT No data
Right 1106821752 13:33472573-33472595 TGTTCCCTAGAGCAGGTAGAGGG No data
1106821745_1106821752 28 Left 1106821745 13:33472522-33472544 CCCCTCAGTTGCGAGTTGTCACA No data
Right 1106821752 13:33472573-33472595 TGTTCCCTAGAGCAGGTAGAGGG No data
1106821748_1106821752 -8 Left 1106821748 13:33472558-33472580 CCAGACAGTGCCAGTTGTTCCCT No data
Right 1106821752 13:33472573-33472595 TGTTCCCTAGAGCAGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106821752 Original CRISPR TGTTCCCTAGAGCAGGTAGA GGG Intergenic
No off target data available for this crispr