ID: 1106822347

View in Genome Browser
Species Human (GRCh38)
Location 13:33479041-33479063
Sequence CAACAGCTCTATAGAAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106822342_1106822347 16 Left 1106822342 13:33479002-33479024 CCTAATATATAAAGAGATTTTAT No data
Right 1106822347 13:33479041-33479063 CAACAGCTCTATAGAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106822347 Original CRISPR CAACAGCTCTATAGAAAAAT GGG Intergenic
No off target data available for this crispr