ID: 1106827818

View in Genome Browser
Species Human (GRCh38)
Location 13:33542958-33542980
Sequence CCTCCCGCGCGGGAACTCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106827818_1106827827 18 Left 1106827818 13:33542958-33542980 CCGCCGAGTTCCCGCGCGGGAGG No data
Right 1106827827 13:33542999-33543021 AAGCGGAAGCTGCCTGTAGGAGG No data
1106827818_1106827826 15 Left 1106827818 13:33542958-33542980 CCGCCGAGTTCCCGCGCGGGAGG No data
Right 1106827826 13:33542996-33543018 CTGAAGCGGAAGCTGCCTGTAGG No data
1106827818_1106827825 1 Left 1106827818 13:33542958-33542980 CCGCCGAGTTCCCGCGCGGGAGG No data
Right 1106827825 13:33542982-33543004 ACTTTGTGGCGACTCTGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106827818 Original CRISPR CCTCCCGCGCGGGAACTCGG CGG (reversed) Intergenic
No off target data available for this crispr