ID: 1106832565

View in Genome Browser
Species Human (GRCh38)
Location 13:33601381-33601403
Sequence ACGATCAGGTTCACCTTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106832565_1106832575 23 Left 1106832565 13:33601381-33601403 CCTTACAAGGTGAACCTGATCGT No data
Right 1106832575 13:33601427-33601449 ACTTTGTGGAAGTGCCTCAGGGG No data
1106832565_1106832568 -1 Left 1106832565 13:33601381-33601403 CCTTACAAGGTGAACCTGATCGT No data
Right 1106832568 13:33601403-33601425 TGTCAAACTGCGCTAGCCCTGGG No data
1106832565_1106832570 9 Left 1106832565 13:33601381-33601403 CCTTACAAGGTGAACCTGATCGT No data
Right 1106832570 13:33601413-33601435 CGCTAGCCCTGGGGACTTTGTGG No data
1106832565_1106832567 -2 Left 1106832565 13:33601381-33601403 CCTTACAAGGTGAACCTGATCGT No data
Right 1106832567 13:33601402-33601424 GTGTCAAACTGCGCTAGCCCTGG No data
1106832565_1106832573 21 Left 1106832565 13:33601381-33601403 CCTTACAAGGTGAACCTGATCGT No data
Right 1106832573 13:33601425-33601447 GGACTTTGTGGAAGTGCCTCAGG No data
1106832565_1106832569 0 Left 1106832565 13:33601381-33601403 CCTTACAAGGTGAACCTGATCGT No data
Right 1106832569 13:33601404-33601426 GTCAAACTGCGCTAGCCCTGGGG No data
1106832565_1106832574 22 Left 1106832565 13:33601381-33601403 CCTTACAAGGTGAACCTGATCGT No data
Right 1106832574 13:33601426-33601448 GACTTTGTGGAAGTGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106832565 Original CRISPR ACGATCAGGTTCACCTTGTA AGG (reversed) Intergenic
No off target data available for this crispr