ID: 1106839283

View in Genome Browser
Species Human (GRCh38)
Location 13:33669462-33669484
Sequence ACCGCTTGCTCACCTCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106839279_1106839283 5 Left 1106839279 13:33669434-33669456 CCATCGCCAGTGGTCCTTTGGGA No data
Right 1106839283 13:33669462-33669484 ACCGCTTGCTCACCTCCATCTGG No data
1106839281_1106839283 -9 Left 1106839281 13:33669448-33669470 CCTTTGGGACTTCCACCGCTTGC No data
Right 1106839283 13:33669462-33669484 ACCGCTTGCTCACCTCCATCTGG No data
1106839275_1106839283 30 Left 1106839275 13:33669409-33669431 CCTGGGTTCACTGGTGTGTGGCA No data
Right 1106839283 13:33669462-33669484 ACCGCTTGCTCACCTCCATCTGG No data
1106839280_1106839283 -1 Left 1106839280 13:33669440-33669462 CCAGTGGTCCTTTGGGACTTCCA No data
Right 1106839283 13:33669462-33669484 ACCGCTTGCTCACCTCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106839283 Original CRISPR ACCGCTTGCTCACCTCCATC TGG Intergenic