ID: 1106843608

View in Genome Browser
Species Human (GRCh38)
Location 13:33712781-33712803
Sequence CTGTAAGGAGGTATGGCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106843608_1106843613 -2 Left 1106843608 13:33712781-33712803 CCAGACGCCATACCTCCTTACAG No data
Right 1106843613 13:33712802-33712824 AGCTCCACTTCCTAATCTCTGGG No data
1106843608_1106843612 -3 Left 1106843608 13:33712781-33712803 CCAGACGCCATACCTCCTTACAG No data
Right 1106843612 13:33712801-33712823 CAGCTCCACTTCCTAATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106843608 Original CRISPR CTGTAAGGAGGTATGGCGTC TGG (reversed) Intergenic
No off target data available for this crispr