ID: 1106846837

View in Genome Browser
Species Human (GRCh38)
Location 13:33745873-33745895
Sequence GAGTGTTTCAAAGATGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106846832_1106846837 5 Left 1106846832 13:33745845-33745867 CCACAGGCCAGTCGTCTCCACAG No data
Right 1106846837 13:33745873-33745895 GAGTGTTTCAAAGATGCTGATGG No data
1106846835_1106846837 -2 Left 1106846835 13:33745852-33745874 CCAGTCGTCTCCACAGGAGGAGA No data
Right 1106846837 13:33745873-33745895 GAGTGTTTCAAAGATGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106846837 Original CRISPR GAGTGTTTCAAAGATGCTGA TGG Intergenic
No off target data available for this crispr