ID: 1106849747

View in Genome Browser
Species Human (GRCh38)
Location 13:33777126-33777148
Sequence GGACAAGTATTGTCACCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106849741_1106849747 26 Left 1106849741 13:33777077-33777099 CCAGCAAGTGTGGGTTGAGTTTG No data
Right 1106849747 13:33777126-33777148 GGACAAGTATTGTCACCTCTTGG No data
1106849745_1106849747 -6 Left 1106849745 13:33777109-33777131 CCTACCTCAGTGACATTGGACAA No data
Right 1106849747 13:33777126-33777148 GGACAAGTATTGTCACCTCTTGG No data
1106849746_1106849747 -10 Left 1106849746 13:33777113-33777135 CCTCAGTGACATTGGACAAGTAT No data
Right 1106849747 13:33777126-33777148 GGACAAGTATTGTCACCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106849747 Original CRISPR GGACAAGTATTGTCACCTCT TGG Intergenic
No off target data available for this crispr