ID: 1106850721

View in Genome Browser
Species Human (GRCh38)
Location 13:33787724-33787746
Sequence CTTATTCACAACCTCTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106850721_1106850724 28 Left 1106850721 13:33787724-33787746 CCAATAAAGAGGTTGTGAATAAG No data
Right 1106850724 13:33787775-33787797 TTATTTTGGAGTCTATGTTTTGG No data
1106850721_1106850723 14 Left 1106850721 13:33787724-33787746 CCAATAAAGAGGTTGTGAATAAG No data
Right 1106850723 13:33787761-33787783 CAATTCTTAAAATATTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106850721 Original CRISPR CTTATTCACAACCTCTTTAT TGG (reversed) Intergenic
No off target data available for this crispr