ID: 1106851285

View in Genome Browser
Species Human (GRCh38)
Location 13:33795549-33795571
Sequence CCTTCCAAGCTTACAGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106851285_1106851291 0 Left 1106851285 13:33795549-33795571 CCCACCACTGTAAGCTTGGAAGG No data
Right 1106851291 13:33795572-33795594 AGGTCATGTGCCAGGAAATGTGG No data
1106851285_1106851290 -8 Left 1106851285 13:33795549-33795571 CCCACCACTGTAAGCTTGGAAGG No data
Right 1106851290 13:33795564-33795586 TTGGAAGGAGGTCATGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106851285 Original CRISPR CCTTCCAAGCTTACAGTGGT GGG (reversed) Intergenic
No off target data available for this crispr