ID: 1106853615

View in Genome Browser
Species Human (GRCh38)
Location 13:33822042-33822064
Sequence AATCATATGCTGAGTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106853612_1106853615 24 Left 1106853612 13:33821995-33822017 CCTTCATATCTTCTGGTAAAATG 0: 1
1: 0
2: 1
3: 39
4: 542
Right 1106853615 13:33822042-33822064 AATCATATGCTGAGTGTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106853615 Original CRISPR AATCATATGCTGAGTGTGGA TGG Intronic
901585549 1:10288098-10288120 AATCATATGCAGGGTGGGGCTGG + Intronic
904300009 1:29548164-29548186 GATTACATGCTGAGGGTGGAGGG + Intergenic
904605996 1:31698033-31698055 AAGCTGATGCTGAGTGTGGCTGG - Exonic
908996435 1:70161591-70161613 ATTCATTTGGTGAGTTTGGAGGG + Intronic
909539210 1:76772092-76772114 AGGCATATGGTCAGTGTGGAAGG - Intergenic
912642491 1:111360774-111360796 AATCATATGCAGAGGGGAGATGG - Intergenic
918365961 1:183807805-183807827 AATCATATTCTGAGTAAGGTAGG - Intronic
918951170 1:191141083-191141105 AATACTATGCTGAGTATGAATGG + Intergenic
919991833 1:202712666-202712688 AATAATAGGCTGGGTGTGGAGGG - Intergenic
923533065 1:234826991-234827013 AATAATATGATGAGAGAGGATGG + Intergenic
1064745079 10:18470777-18470799 TCTCAAATGCTGGGTGTGGATGG + Intronic
1064851394 10:19712917-19712939 ACTCAAATGCTGTGTGTTGAAGG + Intronic
1064887889 10:20132696-20132718 ACTCATATGCTGAAAGTGAAAGG - Intronic
1067406942 10:46031850-46031872 AGTCATAGGCTGTGAGTGGAAGG + Intergenic
1067914462 10:50381692-50381714 GCTCATTTGCTGAGTGTGGTTGG - Intronic
1077652051 11:3981754-3981776 AATCATGTGCAGAATCTGGATGG + Intronic
1078841556 11:15080318-15080340 GATCAGAGGCTGAGGGTGGAAGG - Intronic
1078938589 11:15975367-15975389 AATCACATTATGAGTGTAGAGGG + Intronic
1080546235 11:33321773-33321795 GATAATCTTCTGAGTGTGGAAGG + Intronic
1084654402 11:70506738-70506760 AATAATATGCTGATTCTGGAGGG - Intronic
1088271391 11:108038187-108038209 AATGATATGTTGGGTGTGGTGGG + Intronic
1088585456 11:111356774-111356796 AATGAAATAATGAGTGTGGAGGG - Intronic
1091108717 11:132945165-132945187 AGTCATATGCTGCTTATGGAGGG + Intronic
1092651612 12:10641194-10641216 AATCCTGTGCTGAGTGGGGGTGG - Intronic
1093195779 12:16128125-16128147 GTTCATAAGGTGAGTGTGGAGGG + Intergenic
1100119231 12:91348855-91348877 GATCAGATACTGAGGGTGGAAGG + Intergenic
1101148791 12:101866058-101866080 AATAATTTGGTGAGTGGGGAAGG + Intergenic
1104480416 12:129103093-129103115 AAACATATGCTGATTTTGTAGGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106044929 13:26129996-26130018 CATTATATGCTAACTGTGGAAGG + Intergenic
1106853615 13:33822042-33822064 AATCATATGCTGAGTGTGGATGG + Intronic
1108898458 13:55365695-55365717 AATATAATGCTGAGTATGGATGG - Intergenic
1109531824 13:63659681-63659703 AATCATATGTGAAGGGTGGAGGG + Intergenic
1113070143 13:106412314-106412336 CACCACAGGCTGAGTGTGGAAGG - Intergenic
1113286783 13:108858515-108858537 AATCAGATGTGGGGTGTGGAAGG - Intronic
1113479419 13:110609608-110609630 AATCTTATGCTGGGCCTGGAGGG - Intergenic
1116801342 14:49447041-49447063 AATCATAAGATGAGTGTAGGTGG - Intergenic
1117434517 14:55703343-55703365 AATCACAGGCTGAGGATGGAGGG + Intergenic
1117931423 14:60845560-60845582 AATCATATGCTTAATGTGAGTGG - Intronic
1119058996 14:71454899-71454921 AATCATGTGCTGAGTGAGACGGG + Intronic
1121277166 14:92676375-92676397 AGTGGTTTGCTGAGTGTGGATGG - Intronic
1124873192 15:33564267-33564289 AATCCTAAGCTGACCGTGGATGG + Intronic
1126982545 15:54260376-54260398 GATCATATGCTGAGAATGGAGGG + Intronic
1131608619 15:93936767-93936789 CATCATTTGCTGATTTTGGAGGG + Intergenic
1132317760 15:100902331-100902353 AATAATATGCTGAGGTTAGACGG - Intronic
1134165712 16:11927681-11927703 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134495022 16:14726128-14726150 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134495045 16:14726256-14726278 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134500406 16:14765248-14765270 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134500429 16:14765376-14765398 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134526946 16:14951860-14951882 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134526969 16:14951988-14952010 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134545469 16:15104560-15104582 TATCATCCGCTGAGGGTGGAAGG + Intronic
1134580151 16:15363674-15363696 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134580185 16:15363871-15363893 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134714512 16:16350268-16350290 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134714534 16:16350394-16350416 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134714556 16:16350522-16350544 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134722387 16:16393632-16393654 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134722409 16:16393758-16393780 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134722431 16:16393886-16393908 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134944996 16:18317983-18318005 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134945018 16:18318111-18318133 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134945040 16:18318237-18318259 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134952260 16:18358136-18358158 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1134952282 16:18358264-18358286 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1134952304 16:18358390-18358412 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1135310926 16:21404063-21404085 GATCATCCGCTGAGGGTGGAAGG + Intronic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135311051 16:21404786-21404808 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311075 16:21404924-21404946 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311084 16:21404981-21405003 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311094 16:21405038-21405060 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311104 16:21405095-21405117 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135363876 16:21836500-21836522 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364002 16:21837237-21837259 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364026 16:21837375-21837397 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364036 16:21837432-21837454 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364046 16:21837489-21837511 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364056 16:21837546-21837568 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135447786 16:22533802-22533824 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447796 16:22533859-22533881 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447806 16:22533916-22533938 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447815 16:22533973-22533995 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447839 16:22534111-22534133 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1135447939 16:22534710-22534732 GATCATCCGCTGAGGGTGGAAGG - Exonic
1136104068 16:28016369-28016391 AAGCAGATGCTGAGGGTTGAAGG + Intronic
1136257543 16:29052248-29052270 TATCATCCGCTGAGGGTGGAAGG - Exonic
1136307775 16:29383896-29383918 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136307800 16:29384034-29384056 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136307810 16:29384091-29384113 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321131 16:29485093-29485115 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321170 16:29485326-29485348 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321195 16:29485464-29485486 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321205 16:29485521-29485543 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321214 16:29485578-29485600 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321224 16:29485635-29485657 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435746 16:30224685-30224707 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435851 16:30225296-30225318 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435876 16:30225434-30225456 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435885 16:30225491-30225513 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435894 16:30225548-30225570 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435904 16:30225605-30225627 TATCATCCGCTGAGGGTGGAAGG + Exonic
1143532212 17:7512106-7512128 AGTCAGGTGCTGTGTGTGGAGGG + Intronic
1143695446 17:8612324-8612346 AATCATATGCTGAGGCTGCTAGG + Intronic
1146791613 17:35753771-35753793 AATCACATGGTTAGTGTGGGGGG - Intronic
1147621266 17:41869097-41869119 AATCTTATCCTGAATGTAGATGG - Exonic
1149354103 17:55822042-55822064 AATCAGGTGCTGGGGGTGGAGGG - Intronic
1153260417 18:3218323-3218345 AAGAATATGCTGAGTTTAGAAGG - Intronic
1157577252 18:48751639-48751661 AATCATATCAGGAGTCTGGAGGG + Intronic
1158365394 18:56728633-56728655 ATCCATATGGTGAGTGGGGATGG - Intronic
1159449283 18:68578909-68578931 AATTATATGTTGAATGTGCAGGG - Intergenic
1160551691 18:79697421-79697443 AAGAATAGGCTGAGCGTGGAAGG + Intronic
1166194255 19:41195664-41195686 ACTCATAAGATGAGTGGGGAGGG + Intronic
1166614936 19:44235179-44235201 ATCCATGTGGTGAGTGTGGAAGG + Exonic
1168135576 19:54349173-54349195 AAACAGATCCTGAGGGTGGATGG + Intergenic
925126717 2:1462150-1462172 AAGCATGTGCTCCGTGTGGAAGG - Intronic
925535880 2:4916103-4916125 AATAAAATGCTGAATGAGGAGGG + Intergenic
926576810 2:14591589-14591611 TTTAAAATGCTGAGTGTGGAAGG - Intergenic
928308703 2:30192314-30192336 AATGATATAGTGAGTGTGGTTGG - Intergenic
928530582 2:32186843-32186865 AAAAATATGCTGGGTGTGGTGGG + Intronic
929653584 2:43706905-43706927 AATCATATGCTGGCTGGGCACGG + Intronic
935467953 2:103421613-103421635 AATGATATGCTTAGTGCTGACGG + Intergenic
935980312 2:108620034-108620056 AAACATATGCTGTGTTTGAATGG + Intronic
936994069 2:118395332-118395354 ATTCAAGTGATGAGTGTGGAAGG - Intergenic
939872920 2:147544947-147544969 AATTACATGCTGAGTGTGATGGG + Intergenic
942511334 2:176705508-176705530 AGTCATAACCTAAGTGTGGAAGG - Intergenic
942795254 2:179810870-179810892 AATCATATCTTCAGTGAGGAGGG - Intronic
943327953 2:186524283-186524305 AAACATTTTTTGAGTGTGGAAGG + Intergenic
947912825 2:233812592-233812614 AATGATATGCTGAGTACTGAAGG + Intronic
1169647109 20:7824117-7824139 AATCATATGTCCAGTGTGGCTGG + Intergenic
1176431564 21:6579335-6579357 GTCCATCTGCTGAGTGTGGAAGG - Intergenic
1177031823 21:15989881-15989903 AATCAAATGCTTAATCTGGATGG - Intergenic
1179706958 21:43186797-43186819 GTCCATCTGCTGAGTGTGGAAGG - Intergenic
1182266477 22:29119773-29119795 ACTAATATGCTCAGTGTGGTGGG + Intronic
1182563374 22:31179524-31179546 AAATATTTGCTGAGTGAGGATGG - Intronic
1182779268 22:32854723-32854745 AATTGAATGCTGAGTGTGGACGG + Intronic
1183118296 22:35709072-35709094 AGTCAAAAGATGAGTGTGGATGG + Intergenic
949239086 3:1848450-1848472 AATCATAGGCTTAATGTTGATGG - Intergenic
949934177 3:9103850-9103872 ATCCAGAAGCTGAGTGTGGAAGG - Intronic
952001950 3:28796262-28796284 AATTATATAATGAGTGTGTAGGG + Intergenic
952648182 3:35687973-35687995 AATCATATGCAGGGTTTGGTGGG - Intronic
952794102 3:37223722-37223744 AAGCAGATGCTGAGAGTGCAAGG - Intergenic
953642482 3:44722160-44722182 TCTCATATGCTGAGTGAGGCAGG - Exonic
953686286 3:45080889-45080911 AATCACATGGTGAGAGAGGAAGG - Intergenic
959022845 3:101207674-101207696 TATCTTAAGCTGGGTGTGGATGG + Intergenic
960443853 3:117723195-117723217 AATCATTTGATGAATGTGAAAGG + Intergenic
962920364 3:139944656-139944678 GAGCAAATGCTGAGTGTTGAGGG + Intronic
965632411 3:170746802-170746824 GATTATTTGCTGAGGGTGGAGGG - Intronic
970705420 4:18795662-18795684 AATCATATGTTGATTGCAGAGGG - Intergenic
971273117 4:25170276-25170298 GATCATATGCTCAGTGTGATGGG - Intronic
972961194 4:44454113-44454135 AATGATATTCTGATTCTGGATGG + Intergenic
978295338 4:107198469-107198491 GATGATATGCTGGGTGTTGATGG - Intronic
981222011 4:142248074-142248096 AAACATATCCTGGGAGTGGAAGG - Intronic
982062727 4:151620943-151620965 AAACAAATGCAGAGAGTGGAGGG + Intronic
982239161 4:153281208-153281230 TTTCATATGCTGTGGGTGGAAGG + Intronic
983082406 4:163402813-163402835 GATCATCTGCTGAGAGTGCAAGG + Intergenic
983280737 4:165678011-165678033 AATCTAATGCTGGGTGGGGATGG + Intergenic
983993614 4:174153590-174153612 AATCACTTTCTGAATGTGGATGG - Intergenic
985349990 4:189049847-189049869 AGTCACATGCTGAGGGTTGAGGG - Intergenic
991018048 5:61952088-61952110 GATCGGATGCTGGGTGTGGAGGG - Intergenic
993120464 5:83768060-83768082 AATCAGAAGCTGTATGTGGAGGG - Intergenic
994877385 5:105442467-105442489 AATCAGATATTGAGTGTGGAAGG - Intergenic
995865422 5:116685245-116685267 AGTCCTATGCAGACTGTGGAGGG + Intergenic
996190474 5:120534643-120534665 CAACTTATGCTGAGTGTGTAAGG - Intronic
997879452 5:137576339-137576361 GTTCCTATGCTGAGTGTGTAGGG - Intronic
998598531 5:143560167-143560189 AATCAGATGTTCAGTTTGGAGGG + Intergenic
999517701 5:152317559-152317581 AATCAAAAGCTGCATGTGGAAGG + Intergenic
999802253 5:155049019-155049041 AATCAGATGCTGTGTGGGGTGGG + Intergenic
1000216122 5:159158335-159158357 AATCAGATTTTGAGTGTTGAAGG - Exonic
1000313255 5:160064708-160064730 AAGCACAGGCTGAGGGTGGATGG + Intronic
1001889060 5:175323954-175323976 AATCATCTGTTGAGTGTTTATGG - Intergenic
1005922905 6:30416977-30416999 AATCATGTGCTGATTGCTGAGGG + Intergenic
1008489381 6:52069762-52069784 AATGAAATGATGAGTGTGAAAGG + Intronic
1011246244 6:85324089-85324111 AATTCTATGCTGTGTGTGGATGG - Intergenic
1013684992 6:112570383-112570405 ATTCATATGCTGTTTGAGGATGG + Intergenic
1016446221 6:144134525-144134547 GAGCATATGTTGAGTGTTGATGG + Intergenic
1017404151 6:154098903-154098925 AAACAAATTCTGAGTGTGAAGGG - Intronic
1020646739 7:10823776-10823798 AATCATATCCTCAGTGAAGAAGG - Intergenic
1021528102 7:21611274-21611296 AACCAGATGCTGAGGGTGGGAGG - Intronic
1022172042 7:27840240-27840262 AGCCATTTGGTGAGTGTGGAGGG - Intronic
1024051269 7:45624870-45624892 AATCAGATGCTAGGAGTGGAGGG - Intronic
1024117473 7:46207531-46207553 CATCGCATGCTGAGGGTGGAAGG - Intergenic
1027597127 7:80187427-80187449 AATCACATGCAGAGTGGGTAAGG + Intronic
1027815211 7:82959731-82959753 AATCCTGTGAGGAGTGTGGAGGG - Intronic
1027837947 7:83270006-83270028 TATAAAATGCAGAGTGTGGATGG + Intergenic
1036584368 8:10109492-10109514 AATAATTAGCTGAGTGTGGTAGG - Intronic
1037623080 8:20584109-20584131 ATTCAGATACTGAGGGTGGAGGG + Intergenic
1038688855 8:29742977-29742999 AATCATATGCTTAGAGGGGTTGG + Intergenic
1040810992 8:51453461-51453483 AATAATTTTCTGAGTGTGGCAGG + Intronic
1043633091 8:82362034-82362056 ATTCATATGGTGAGTGCTGATGG - Intergenic
1044489399 8:92794162-92794184 AATCAAATGCTGAAAGTGTAAGG + Intergenic
1044506045 8:93020733-93020755 AATCAGATGCTGACTGAGGAGGG + Intergenic
1044509875 8:93062536-93062558 AATCATAGGCTGAAAGTGAAAGG + Intergenic
1045030235 8:98128050-98128072 AATGCTGTGCTGAGTGTGGATGG - Intronic
1050010924 9:1185271-1185293 AAACATCTCCTGATTGTGGATGG - Intergenic
1050443619 9:5694036-5694058 AATTATATGGGGAGGGTGGAGGG - Intronic
1051336435 9:16070383-16070405 AATCATATGATGTGTGTGGTGGG + Intergenic
1052301745 9:26959735-26959757 AGTCATCTGCTGAGAGTGGCAGG + Intronic
1053159670 9:35805381-35805403 AATAATAAGCTGATTTTGGAAGG - Intronic
1056634899 9:88323356-88323378 AATCATGTGCACAGTCTGGAGGG + Intergenic
1060705960 9:125801456-125801478 AATCATATGCTAATTTTTGAAGG - Intronic
1060961932 9:127687095-127687117 AATCATTTGCTGAGTGGTGTTGG + Intronic
1190702848 X:53000932-53000954 ATACAAATGCTGTGTGTGGAGGG - Intergenic
1190808606 X:53862646-53862668 GATCATATGCTGAGTTTGAGAGG - Intergenic
1190936410 X:55002407-55002429 GATCTTATGCTGTGTGAGGAGGG - Exonic
1192094201 X:68193232-68193254 AAGCATATGCTTAGTTTGGGCGG + Intronic
1192472301 X:71409755-71409777 AATATAATGCTGAGTGTGGCAGG - Intronic
1193922129 X:87442265-87442287 ATTCATATGCTAAGAGGGGAGGG - Intergenic
1194073082 X:89351221-89351243 GATAATTTGCTGAGAGTGGATGG - Intergenic
1194669304 X:96710659-96710681 CATCATATGGTGGGAGTGGAGGG - Intronic
1195392916 X:104381745-104381767 AATCATCTGCTGAAAGTGTAAGG - Intergenic
1195632040 X:107067309-107067331 GATGATATGCTGAGTATGAAGGG - Exonic
1196189225 X:112777590-112777612 AATCATTTGCAAAGTGAGGAAGG - Exonic
1198448547 X:136742820-136742842 AAACATTAGCTGGGTGTGGAAGG + Intronic
1199055323 X:143287230-143287252 AAAAATATCCTGACTGTGGAGGG + Intergenic
1200727317 Y:6686961-6686983 GATAATTTGCTGAGAGTGGATGG - Intergenic
1200728469 Y:6702736-6702758 GATAATTTGCTGAGAGTGGATGG - Intergenic