ID: 1106854335

View in Genome Browser
Species Human (GRCh38)
Location 13:33832159-33832181
Sequence ATGTTAAGGCCCACTAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106854332_1106854335 -3 Left 1106854332 13:33832139-33832161 CCTCCAAATAAAAAATGACAATG 0: 1
1: 0
2: 8
3: 67
4: 746
Right 1106854335 13:33832159-33832181 ATGTTAAGGCCCACTAACTTTGG 0: 1
1: 0
2: 0
3: 4
4: 98
1106854333_1106854335 -6 Left 1106854333 13:33832142-33832164 CCAAATAAAAAATGACAATGTTA 0: 1
1: 0
2: 5
3: 57
4: 714
Right 1106854335 13:33832159-33832181 ATGTTAAGGCCCACTAACTTTGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106854335 Original CRISPR ATGTTAAGGCCCACTAACTT TGG Intronic
908943944 1:69471411-69471433 ATGTTATAGGCCACTAAGTTTGG + Intergenic
916268964 1:162919730-162919752 ATGATAAGGCCCACTGGCCTGGG - Intergenic
922194643 1:223349472-223349494 ATGTTATGGCCCTGTAATTTGGG + Intronic
924147459 1:241090963-241090985 ATGTGAAGGACAACTAACGTGGG + Intronic
1069187554 10:65444427-65444449 ATTTTAAGGCACAATAACTGTGG - Intergenic
1070318539 10:75336994-75337016 ATCTTAAGGTCAACTGACTTGGG + Intergenic
1072099219 10:92213765-92213787 ATGTTAAAGCCCAACAACTAGGG + Intronic
1074497554 10:113993039-113993061 ATGTGAAAGCCCACTCACTCTGG + Intergenic
1076095561 10:127732751-127732773 ATCTTAAGGTCAACTGACTTAGG + Intergenic
1078738574 11:14044930-14044952 ATCTAAATGTCCACTAACTTTGG - Intronic
1081826079 11:46053425-46053447 ATATTTAGGCCCAGCAACTTTGG - Intronic
1087803509 11:102530568-102530590 ATGTCACAGCCCACTTACTTAGG - Intronic
1088377710 11:109160059-109160081 ATGTTAATCCCCAGGAACTTGGG - Intergenic
1093190239 12:16065810-16065832 ATATTAAGTCCCACTAAATGTGG + Intergenic
1098360119 12:69646361-69646383 ATTTTCAGGTCTACTAACTTTGG + Intronic
1098770534 12:74547171-74547193 ATGTTAAGGTCAACTGACTTGGG - Intergenic
1099422398 12:82478168-82478190 ATTTTATCACCCACTAACTTAGG - Intronic
1099445478 12:82746663-82746685 ATCTTAAGGCCAACTGATTTGGG - Intronic
1099791142 12:87335421-87335443 GCATTAAGGCCCTCTAACTTTGG - Intergenic
1100777138 12:97987853-97987875 ATGTCAAGGTGCTCTAACTTTGG - Intergenic
1100793185 12:98153024-98153046 AAGTTAATGCCAGCTAACTTTGG + Intergenic
1105566874 13:21558309-21558331 ATGTTAAGCTCCACTAATTTGGG + Intronic
1106854335 13:33832159-33832181 ATGTTAAGGCCCACTAACTTTGG + Intronic
1107906665 13:45067500-45067522 ATCTTAAAGTCCACTGACTTGGG + Intergenic
1119263783 14:73252802-73252824 ATGATGAGGCCCAAGAACTTGGG + Intronic
1124145424 15:27120947-27120969 ATTTTAAGGTCAACTAAGTTTGG - Intronic
1130711321 15:86284418-86284440 AAGTTAAGTCCCTTTAACTTGGG + Intronic
1131822741 15:96289517-96289539 AAGTTAAGGAACACTAACCTAGG + Intergenic
1131868109 15:96733323-96733345 ATGTCAAGGTCTACTAAATTTGG + Intergenic
1135232342 16:20720606-20720628 ATGTTAAGGCCCTTAAACTAGGG - Intronic
1140047152 16:71448294-71448316 ATGTTAATGCCCATTTAATTCGG - Exonic
1143423566 17:6815145-6815167 ACGGCAAGGCCCACTCACTTTGG + Exonic
1147026966 17:37594837-37594859 ATGTTAAGGCCACATTACTTTGG + Intronic
1155481627 18:26295326-26295348 ATGTTAGGGACCAATGACTTAGG - Intronic
1156417166 18:36908670-36908692 ATGTTATTGCAAACTAACTTGGG + Intronic
1156866779 18:41897515-41897537 ATGAGAAGGCCCTCTAATTTTGG - Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
1165752792 19:38271059-38271081 ATGCTGAGGCCCAGGAACTTTGG + Intronic
929695397 2:44110547-44110569 ATCTTAAAGTCAACTAACTTGGG - Intergenic
932097875 2:68867694-68867716 ATGCTAAGGACCACCAACTGGGG + Intronic
934584189 2:95475344-95475366 ATGTTAAGAACCACTGACTGGGG - Intergenic
934595263 2:95601370-95601392 ATGTTAAGAACCACTGACTGGGG + Intergenic
935810493 2:106792538-106792560 ATGTTGGGGACCACTGACTTAGG + Intergenic
936950452 2:117972903-117972925 ATGTTAAGAAACACTTACTTGGG + Intronic
938295709 2:130177972-130177994 AACTTAAGGTCCACTAACTTAGG - Intronic
938460910 2:131495861-131495883 AACTTAAGGTCCCCTAACTTAGG + Intergenic
939844270 2:147224319-147224341 ATGTTCAGCCCCTCTGACTTCGG + Intergenic
943332349 2:186574613-186574635 ATGTTAAGACCTGCTATCTTTGG - Intergenic
1173760944 20:45560030-45560052 ATCTTAAAGTCAACTAACTTGGG - Intronic
1177066064 21:16437829-16437851 ATGTAAATGCCTTCTAACTTGGG + Intergenic
1183400688 22:37602184-37602206 AGGTTAAGGTTCTCTAACTTTGG + Intergenic
950937138 3:16850666-16850688 ATTTTAAGGCACACTGACCTGGG - Intronic
951770717 3:26253946-26253968 ATGTTAAAATCTACTAACTTGGG + Intergenic
956506636 3:69947534-69947556 ATTTCAAGGCCCTCTAACTAAGG - Intronic
957887310 3:86304032-86304054 ATATAAAAGCCCACTAAGTTTGG - Intergenic
963007859 3:140742664-140742686 AAGTTAAGACTCACAAACTTGGG + Intergenic
963326322 3:143867128-143867150 ATAATAATGCCCACTAAATTGGG - Intergenic
966565442 3:181375624-181375646 TTGTGAAGGCCCTCTAACATGGG - Intergenic
966586906 3:181636361-181636383 ATGTAAAAGCTCTCTAACTTTGG + Intergenic
970639116 4:18044204-18044226 TTTTTAAGGCCAACTGACTTGGG - Intergenic
976807487 4:89064356-89064378 ATGTTAAGTCAAACTAAATTTGG + Intronic
982893693 4:160889058-160889080 ATGTTAAGTCCCATAAACATGGG - Intergenic
984962513 4:185111456-185111478 ATGTTCAGGCTCACTGACATGGG - Intergenic
985106911 4:186509180-186509202 ATGATAAGGCCCAAGAACTATGG + Intronic
987981062 5:25084171-25084193 ATTATAAGGTCCTCTAACTTGGG - Intergenic
989125705 5:38050632-38050654 ATCTTAAGGTCAACTGACTTTGG - Intergenic
991745979 5:69741559-69741581 AGGATAAGGCCCACTAGCCTGGG - Intergenic
991751725 5:69813682-69813704 AGGATAAGGCCCACTAGCCTGGG + Intergenic
991797581 5:70321517-70321539 AGGATAAGGCCCACTAGCCTGGG - Intergenic
991825357 5:70616873-70616895 AGGATAAGGCCCACTAGCCTGGG - Intergenic
991831013 5:70688575-70688597 AGGATAAGGCCCACTAGCCTGGG + Intergenic
991889923 5:71320838-71320860 AGGATAAGGCCCACTAGCCTGGG - Intergenic
993509993 5:88759083-88759105 ATGTTAAGGCGGAGTACCTTAGG - Intronic
995967035 5:117919997-117920019 ATGTTAAAGCATTCTAACTTGGG + Intergenic
997569072 5:134911975-134911997 ATGTTCAAGCCCAATAAATTAGG - Intronic
998538795 5:142959731-142959753 ATTTTAAGGTCTACTGACTTGGG + Intronic
1000701984 5:164463070-164463092 ATTTTAATGCTCACTTACTTAGG + Intergenic
1001873371 5:175178044-175178066 ATGTTAAGGTCAATTAATTTTGG - Intergenic
1004162105 6:13223475-13223497 ATTTTAAGTCCTACTAACTAGGG - Intronic
1004564874 6:16786936-16786958 ATGATAAGGCCTAGTATCTTAGG + Intergenic
1004981675 6:21031409-21031431 ATCTTAATGTCCACTAATTTGGG + Intronic
1005556640 6:26992024-26992046 AGGATAAGGCCCACTAGCCTGGG - Intergenic
1011143974 6:84191420-84191442 TTGTAAAGGCCCCCTACCTTGGG - Intronic
1012300973 6:97587568-97587590 TTTTTAAGGCCCACATACTTGGG + Intergenic
1014789127 6:125651926-125651948 ATATTAAGGCCCAATCAATTGGG - Intergenic
1016717241 6:147248792-147248814 ATTTTAAGGTCAACTAATTTGGG - Intronic
1022759868 7:33336227-33336249 ATGTTAAGGTCCACTAAGGCCGG - Intronic
1032995596 7:137442637-137442659 ATGTTCAGGCCCATTAAGTCAGG - Intronic
1041030860 8:53733997-53734019 CTGTTAAGGCCCTCAAACATGGG - Intronic
1046132862 8:109989904-109989926 ATTTTAAGGCCCATTGACATAGG - Intergenic
1050878975 9:10675544-10675566 AGGATAAGGTCCACTAACCTCGG - Intergenic
1051226330 9:14903238-14903260 ATGTCATGGCTCAGTAACTTTGG - Intronic
1051823170 9:21191904-21191926 AGGGTAAGACCCACTGACTTGGG + Intergenic
1053585714 9:39456491-39456513 CTGTTAATGCCCACTCACCTGGG + Intergenic
1054580593 9:66908730-66908752 CTGTTAATGCCCACTCACCTGGG - Exonic
1055981578 9:82008098-82008120 ATGTTAAGAACCACTGATTTAGG + Intergenic
1059033507 9:110727660-110727682 ATGTTCAGGTCCACAAACTCAGG + Intronic
1187775044 X:22746857-22746879 ACACTAATGCCCACTAACTTTGG + Intergenic
1191156962 X:57284177-57284199 AGGATAAGGCCCATTAGCTTGGG - Intergenic
1192067824 X:67904597-67904619 AGGATAAGACCCACTGACTTGGG - Intergenic
1194800149 X:98263179-98263201 ATGTTTTGGAACACTAACTTTGG + Intergenic
1200177512 X:154127269-154127291 ATGTTAAGTCCCAGCTACTTGGG + Intergenic
1202088550 Y:21164181-21164203 AGGTTAAGGCCCACACACTTGGG - Intergenic