ID: 1106863054

View in Genome Browser
Species Human (GRCh38)
Location 13:33932163-33932185
Sequence TAGAATAGACAGATGAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 358}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106863054 Original CRISPR TAGAATAGACAGATGAACAA TGG (reversed) Intronic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
901389877 1:8937948-8937970 TAGAGGAGCCAAATGAACAAGGG - Intergenic
902574706 1:17370195-17370217 TAAAATACACAGCTGTACAAAGG + Intergenic
904050866 1:27637467-27637489 AGGAATTAACAGATGAACAAAGG + Intergenic
905040578 1:34953875-34953897 AAGAATAGAGAGAGGAAGAAAGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
906442543 1:45861169-45861191 TGGAATAGAGAGAGTAACAATGG - Intronic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
908980578 1:69952245-69952267 TAGAATATACTGGTGAACCAGGG - Intronic
909090753 1:71222238-71222260 TAAAAAAGACAAAGGAACAATGG - Intergenic
909215858 1:72887254-72887276 TAGAAAAGTTGGATGAACAATGG + Intergenic
909736284 1:78966613-78966635 TGGAATGGACAGATGAGCAGGGG + Intronic
910135607 1:83965369-83965391 CAGAAGAGACAGAAGAACAAAGG - Intronic
910623310 1:89279622-89279644 TATAAGAGGCAGATGAAAAAGGG + Intergenic
917436643 1:175028829-175028851 TAGAATAGACAGATTAAAAAAGG + Intergenic
919048054 1:192478965-192478987 TAGAACAAACACATAAACAAAGG - Intergenic
919141499 1:193578202-193578224 GAAAGTAGACAGATGAAAAAGGG - Intergenic
919563547 1:199155406-199155428 TAGAAAAGACATTTGAGCAATGG - Intergenic
919781912 1:201226632-201226654 TAGAATACACAGAGAATCAAAGG - Intronic
921247827 1:213264032-213264054 TGGAATAGAGAGATAAATAAAGG + Intronic
921629865 1:217420291-217420313 GAGAAAAGACAGATGATTAAAGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922715864 1:227871447-227871469 TAGAATAGAGAGCTGAGAAATGG + Intergenic
922995011 1:229949662-229949684 AAGGATAGACATATGAACAATGG + Intergenic
924209908 1:241754067-241754089 CAGATTAGAAAAATGAACAAAGG + Intronic
1063398352 10:5715434-5715456 TAGAATAGACAAATCTATAAAGG - Intronic
1063538828 10:6911614-6911636 AACAAAAGACAGATTAACAAGGG - Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1068503650 10:57871119-57871141 TAGAATAGCCTTATGAAAAATGG - Intergenic
1069093950 10:64235728-64235750 TAGAAAAGAGTGATGAAGAAGGG + Intergenic
1069537261 10:69263853-69263875 TAAAAAATACAGATAAACAAAGG + Intronic
1071145980 10:82572653-82572675 TAGAAAAGAAAGAGGAATAAGGG - Intronic
1073418683 10:103406087-103406109 TACATCAGACAGAAGAACAAAGG + Exonic
1074384870 10:113008826-113008848 AGGAACAGAAAGATGAACAAGGG - Intronic
1075746854 10:124733995-124734017 GAGTTTAGACAGATGAAGAACGG - Intronic
1077094654 11:794199-794221 GAGAAGAGACAGATGTACCATGG + Intronic
1079391951 11:20029512-20029534 TAAAATAGGGAGATGAGCAAAGG - Intronic
1079968019 11:27002529-27002551 TAGAATCGACAGATCTATAAAGG + Intergenic
1080300791 11:30782967-30782989 GAGAACAGAGGGATGAACAAAGG + Intergenic
1081019012 11:37919829-37919851 TTGCATAGATAGATGAAGAATGG - Intergenic
1081048669 11:38310195-38310217 TTGTATAGACAGCTGAATAATGG + Intergenic
1083034871 11:59627778-59627800 GAGAAGAGACAGATGTGCAAAGG - Intergenic
1083174188 11:60939066-60939088 TATGATAGAGAGATGAACACGGG + Intronic
1085236374 11:75018650-75018672 TAAAATAGATAGATATACAAAGG - Intronic
1087287364 11:96279440-96279462 TTCAGTATACAGATGAACAAAGG + Intronic
1087359417 11:97139003-97139025 TAGAGTAGATAGTGGAACAAGGG - Intergenic
1087882706 11:103437361-103437383 ATGAAAAGACAGAAGAACAAGGG - Intronic
1088986640 11:114914919-114914941 TAGAAAAGAAAGAGGAACACTGG - Intergenic
1089142113 11:116293738-116293760 AACAAAAGACAGATTAACAAGGG + Intergenic
1089873512 11:121697574-121697596 TAGAGTATACATATTAACAAGGG - Intergenic
1089985241 11:122806386-122806408 TGTAATAGAAAAATGAACAAAGG - Intronic
1090197616 11:124830498-124830520 AAGAAAAGAGAGATGAGCAAAGG + Intergenic
1090542076 11:127717747-127717769 TAAAATACACTAATGAACAATGG + Intergenic
1090555134 11:127866465-127866487 TAGAATGGACACATGAAAGAGGG + Intergenic
1091064672 11:132498308-132498330 AAGAAAAAACAGATGACCAATGG - Intronic
1091342818 11:134831630-134831652 AAGAATAGACAGTTGATCAATGG + Intergenic
1092355508 12:7791625-7791647 TAGAATTGAGAGTTGAACACTGG + Intronic
1092388581 12:8054950-8054972 CAGAAGACACAGATGAACAAGGG - Exonic
1093473597 12:19531450-19531472 AAGGAGAGACAGAAGAACAAAGG - Intronic
1093772889 12:23037945-23037967 TAGAAGAAAAAGATGAACACTGG - Intergenic
1094743324 12:33314482-33314504 TAGAAAAGAAAGCTAAACAATGG + Intergenic
1095260990 12:40099337-40099359 TAGACAAGAAAGATGTACAAAGG + Intronic
1095332472 12:40984221-40984243 TATAACAGACAAATTAACAAAGG - Intronic
1096021335 12:48328191-48328213 CAGAAGAGGTAGATGAACAAGGG - Intergenic
1096931965 12:55221476-55221498 TAGCATAGACACAGGAACACCGG - Exonic
1096943332 12:55374039-55374061 TAGAATAGATAGATAATAAATGG + Intergenic
1097275005 12:57807201-57807223 TGGATTAGACAGAGGAAGAAGGG - Intronic
1097478783 12:60094164-60094186 TAGATTATACAGATTGACAAAGG + Intergenic
1098673747 12:73264094-73264116 TTGAAAAGACAGCTGTACAATGG + Intergenic
1098678710 12:73322674-73322696 CAGAATAGATAAATGAAGAAAGG + Intergenic
1099113295 12:78590006-78590028 TAGAATTGAGAGAAGAAAAAAGG + Intergenic
1101554602 12:105797038-105797060 AAGAAGGGATAGATGAACAAAGG + Intergenic
1102785952 12:115604959-115604981 AAGAATAGATGGATGGACAATGG + Intergenic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106721191 13:32436386-32436408 TAGAAAAGACAGAAGAAGATTGG - Exonic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107597480 13:41977852-41977874 TAGGATAGGCAGATGAACTCAGG + Intergenic
1109266484 13:60206491-60206513 TAAAACACACAGATGCACAATGG - Intergenic
1110109262 13:71723067-71723089 TAGGATAGAGAAATGTACAACGG - Intronic
1110372654 13:74757038-74757060 TGGAATGTACAGATTAACAATGG + Intergenic
1111045011 13:82803832-82803854 CAGTATAGATAGATAAACAAAGG - Intergenic
1111394886 13:87652498-87652520 AAGAATAAACAGACCAACAAAGG - Intergenic
1111459907 13:88525432-88525454 TAGAATAAATACATGAAGAAGGG + Intergenic
1111552769 13:89837332-89837354 TGGAGTAGACAGAAGAGCAAAGG + Intergenic
1113180740 13:107622525-107622547 TAGCAGAGACAGATTATCAATGG - Intronic
1113272397 13:108687665-108687687 CACAATAGAAAAATGAACAAGGG + Intronic
1114172734 14:20289748-20289770 TAGAAAAGACAGACAGACAAAGG + Intronic
1114822282 14:26035284-26035306 TAGAATAGACGCATTAACAATGG - Intergenic
1114933000 14:27498051-27498073 TACAATAAACAGGTGAACTAAGG + Intergenic
1115264704 14:31488983-31489005 TAGATTAGAGAGAAGAACATAGG - Intergenic
1115443813 14:33466457-33466479 TACAATTGCTAGATGAACAACGG - Intronic
1115497174 14:34017529-34017551 TAGAAAAGACAGGTAAACAATGG - Intronic
1116552105 14:46254189-46254211 TAGAAATGAAAGATGAACAAGGG + Intergenic
1116731968 14:48634664-48634686 TAGCATGAACATATGAACAATGG - Intergenic
1117020592 14:51566202-51566224 TAGGATAGTCAAATGAACAAAGG + Intronic
1118418297 14:65569587-65569609 TGGACAAGACAGATGAAAAATGG - Intronic
1118527970 14:66667446-66667468 AAGAATAGACACATAACCAAAGG + Intronic
1119952899 14:78764304-78764326 TAGAGAAGACAGATGACCAAGGG + Intronic
1120003471 14:79330198-79330220 GTTAATAGACAGATGAACAAGGG + Intronic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1120596693 14:86448303-86448325 TAGAATAGAAAAATAAAAAATGG - Intergenic
1121061899 14:90918814-90918836 CAGGATAGACAAATGATCAATGG - Intronic
1121181108 14:91929742-91929764 AAAAATAGACAGATGAACTAGGG + Intronic
1121607442 14:95251770-95251792 CAAAAGAGACAGTTGAACAATGG - Intronic
1121780838 14:96621433-96621455 GAGAATATATAGATGAAAAATGG - Intergenic
1122250318 14:100434582-100434604 TAGAATACAAAGAGAAACAAAGG - Intronic
1123812243 15:23939251-23939273 TGGAAAAGACAAATGTACAAAGG - Intergenic
1124953618 15:34345443-34345465 TAGAATTGTCAGATGATCCAAGG - Intronic
1124953754 15:34346389-34346411 TAAAAAAGACAGATGAACTTGGG - Intronic
1125073365 15:35582959-35582981 TTAGATAGACAAATGAACAAAGG + Intergenic
1125313788 15:38409294-38409316 TACAATGCACACATGAACAAAGG + Intergenic
1125823736 15:42657522-42657544 TAAAATAGACAGTTCAACAATGG + Intronic
1125913504 15:43463433-43463455 AAGAAATAACAGATGAACAAGGG + Intronic
1126419553 15:48457066-48457088 TAGAATAGAGGGATGGTCAAGGG + Intronic
1126728471 15:51656791-51656813 AACAAAAGACAGATTAACAATGG + Intergenic
1127327134 15:57906705-57906727 GAGAATAGACAGAAGAGCATAGG - Intergenic
1127559633 15:60123100-60123122 AACAAAAGACAAATGAACAAGGG - Intergenic
1129146746 15:73655025-73655047 GAGAAAAAACAGATTAACAAGGG - Intergenic
1129288919 15:74548333-74548355 TAGAATAGAAAGAAGAAAGATGG + Intronic
1130216654 15:81978036-81978058 TAGAATAGACAGAGGAGGAGAGG - Intergenic
1130346392 15:83050112-83050134 TACAATAGACAAAAGCACAATGG - Exonic
1130624230 15:85497010-85497032 TAGAACAGACAAAGGTACAAAGG + Intronic
1130865068 15:87926350-87926372 TAGAATACACAGATTTCCAATGG + Intronic
1131004252 15:88963730-88963752 TCAAATAGACAAAAGAACAAAGG - Intergenic
1131696220 15:94880762-94880784 AAGAAAAGACAGAAGAAAAAAGG - Intergenic
1131775457 15:95792079-95792101 GAGAAAAGACAGAGGAAGAAAGG - Intergenic
1132152362 15:99471537-99471559 TAGAATAGAAAGGTGAAGGAAGG + Intergenic
1138174570 16:54884918-54884940 GACAAAAGACAGATTAACAAGGG - Intergenic
1138734699 16:59236950-59236972 TAGATTAGACAGATGCACAGTGG + Intergenic
1138944590 16:61832942-61832964 TCTTATAGACAGATGAAAAAAGG - Intronic
1139296139 16:65902721-65902743 TAGAACAGAAAGGTGAAGAAGGG + Intergenic
1141257887 16:82420072-82420094 TAGAATAAATATATGAAGAAAGG + Intergenic
1142478531 17:204242-204264 GAGGATGGACAGATGAACAGAGG - Intergenic
1143725941 17:8846308-8846330 AAAAATAGACATATAAACAATGG - Intronic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144157387 17:12519385-12519407 TAAAGAAGACAGATGGACAAAGG - Intergenic
1145107668 17:20133123-20133145 AAGAATATACAGATTACCAATGG - Intronic
1146135251 17:30314436-30314458 TAGAAAAGACATATGGAAAAAGG + Intergenic
1146441334 17:32897723-32897745 TAGAAGTGACAGATGAACAGTGG + Intergenic
1146455014 17:33002796-33002818 TAGAATACAAAGATAACCAAAGG + Intergenic
1148801729 17:50231367-50231389 TAGAATACAGAGACTAACAAAGG - Intergenic
1148819468 17:50352323-50352345 TAGAATGGACGGAGGAACAGGGG - Intronic
1149449021 17:56735060-56735082 AAGGATAAACAGATGAACAGAGG - Intergenic
1150361286 17:64536675-64536697 AAGAAAAGCGAGATGAACAAAGG + Exonic
1151143786 17:72020062-72020084 TTGAACAGCCACATGAACAAGGG - Intergenic
1151241192 17:72759302-72759324 TAAAACAGACAAATGAGCAAAGG + Intronic
1153050713 18:901062-901084 TAGAAAAGTTAGAAGAACAATGG - Intergenic
1153379985 18:4427621-4427643 TAGGAGAGACAAATCAACAAAGG + Intronic
1154928964 18:20972544-20972566 TAGAATGGAAAAAGGAACAAAGG + Intronic
1155082171 18:22420945-22420967 TAGAATACACAGATTTATAAAGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155948326 18:31881284-31881306 AAAAATAGACACATGAACAATGG + Intronic
1156748001 18:40415956-40415978 TTCAATAGACAGGAGAACAAAGG - Intergenic
1157034964 18:43960486-43960508 TGGAATAGACAGGTGAGAAAAGG + Intergenic
1157319749 18:46624812-46624834 GAGAAAAGACAGAAGAAGAAAGG - Intronic
1157530633 18:48417802-48417824 TAGAACAGACAAATGCACAAAGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1159112244 18:64072990-64073012 TAGAAAAGACAGGTGGAAAAAGG - Intergenic
1159254154 18:65924034-65924056 CAGGATACACATATGAACAATGG + Intergenic
1159262194 18:66028633-66028655 GGGAATTGACAGATGGACAAAGG + Intergenic
1159529619 18:69639142-69639164 TAGGAAAAACAGATGAACCAAGG + Intronic
1159543909 18:69815312-69815334 TACAATATAAAGGTGAACAAAGG - Intronic
1160444617 18:78917349-78917371 TGGAATGGACAGATGACAAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
925028613 2:629938-629960 TAGAATAGATAGATGACAGATGG - Intergenic
926076032 2:9943717-9943739 TAGAAAAGACATATCAACATGGG + Intergenic
926360898 2:12085662-12085684 TAGATTAGAAGGATGAGCAAAGG + Intergenic
926899985 2:17740245-17740267 TAGGAGAAACAGATGGACAAGGG - Intronic
927834152 2:26378488-26378510 TAGAAGAGAGAGATGCAGAAGGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928745021 2:34402276-34402298 TAGTGTAGGCTGATGAACAAAGG - Intergenic
930329765 2:49967191-49967213 TAGTATTGACAGATATACAACGG + Intronic
931527122 2:63168907-63168929 TAGAAAAGACACAAGTACAAAGG - Intronic
932568158 2:72922398-72922420 TGGAATAGACAGATGGTCAGGGG - Intronic
932792078 2:74662510-74662532 AGGAATAAACTGATGAACAAAGG + Intronic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
935374240 2:102379090-102379112 AACAAAAGACAGATTAACAAGGG + Intronic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936766806 2:115860105-115860127 AAGTATAGACATATGATCAATGG - Intergenic
937197445 2:120172117-120172139 TAGAATAGAAAGATGAAAACTGG + Intronic
937270791 2:120650700-120650722 TCAAATAGACAGTTCAACAATGG - Intergenic
937549504 2:123069608-123069630 AAGAACAGATGGATGAACAAGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938313702 2:130312113-130312135 TAGAAATGACAGAGTAACAAAGG + Intergenic
938610779 2:132945358-132945380 AAGACAGGACAGATGAACAAGGG + Intronic
938875617 2:135529452-135529474 TATAATACACCGATGAATAAAGG - Intronic
939673244 2:145039770-145039792 TAGAACATACAGATTAACAGAGG + Intergenic
941515720 2:166473867-166473889 TAGAATAAACAGTTGGAAAAAGG + Exonic
942303341 2:174583531-174583553 TAGAATATAGAGATGAAGAAAGG - Intronic
943043130 2:182826684-182826706 TACAAAAGAAAGAAGAACAAAGG - Intergenic
943922978 2:193733739-193733761 TTGAATAGACAGATGTAACAAGG + Intergenic
944264684 2:197710308-197710330 TAGATTAGACAGAAGACCTATGG + Intronic
944328762 2:198440438-198440460 TAGATTGGACATATGAAAAATGG + Intronic
945149415 2:206772967-206772989 TCAAATAGAAAGATGACCAAAGG - Intronic
945744524 2:213704048-213704070 GAGAACAGCCAGAAGAACAAGGG - Intronic
945755381 2:213839167-213839189 TAGTATTGACAGTTGAAGAATGG - Intronic
946799432 2:223395571-223395593 TTGAATAGAAATGTGAACAAAGG + Intergenic
1170210496 20:13842253-13842275 AACAAAAGACAGATCAACAAAGG + Intergenic
1171931449 20:31232753-31232775 TAGAATAGACAGATATGGAATGG + Intergenic
1172470442 20:35189804-35189826 AAGGATACAAAGATGAACAAGGG - Intergenic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174940912 20:54926118-54926140 TAGAATATACAGATAGGCAATGG - Intergenic
1175245060 20:57577215-57577237 GAGAATAGACAGATGGATAGTGG + Intergenic
1175880926 20:62258554-62258576 CAGAAAATACAGATGAGCAAAGG - Intronic
1176992259 21:15511477-15511499 TAGAAGAAACAGATGAAAAATGG - Intergenic
1177735051 21:25078823-25078845 TATAATAGAAATATGAAAAAAGG + Intergenic
1179227815 21:39471089-39471111 CAGAATGGACAGAAGAAGAAAGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180533633 22:16374015-16374037 TAGAATAGAATCATGAATAAAGG + Intergenic
1181416419 22:22762613-22762635 AAGATGAGACAGATGAAAAATGG - Intronic
1181633282 22:24162491-24162513 TACAGTAAAGAGATGAACAAGGG + Intronic
1184035608 22:41916486-41916508 GAAAAAACACAGATGAACAAAGG + Intergenic
1203316010 22_KI270737v1_random:11781-11803 TAGAATAGAATCATGAATAAAGG - Intergenic
950986339 3:17372398-17372420 TAAAATAGGAAGATGAAAAAGGG + Intronic
951090422 3:18566891-18566913 TACAGTAGACATTTGAACAAAGG + Intergenic
951108884 3:18777648-18777670 TAGAATAGATAGATAGATAATGG - Intergenic
953576518 3:44117066-44117088 TAGAATCTACAAATGCACAAAGG - Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956063482 3:65372485-65372507 CAGAATAGCCAGATGAGCACTGG + Intronic
956710328 3:72033317-72033339 AACAAAAGACAGATTAACAAGGG + Intergenic
956854143 3:73259361-73259383 AAGAATAAACAGGTGATCAAAGG - Intergenic
957769501 3:84671851-84671873 TAGCACAGACAGAGGAACAAAGG + Intergenic
958665554 3:97132707-97132729 GAGAATACAAAGCTGAACAAAGG + Intronic
958830965 3:99088758-99088780 AACAATAGAGAGAGGAACAATGG + Intergenic
958883489 3:99699488-99699510 TTGGACAGACAGATGATCAAAGG + Intronic
958900985 3:99886575-99886597 TAGAACAAACAAATGAACAAAGG + Intronic
959186914 3:103056533-103056555 TAGACTAGACAAATGAAAAGGGG + Intergenic
959530587 3:107430961-107430983 AAGAATAGATAGACGAACGAAGG + Intergenic
960446490 3:117755812-117755834 TAGAATAGGCAGATGACAAAGGG - Intergenic
960831534 3:121854509-121854531 TAAAAAAGACAGATGAAGATAGG - Intronic
962335792 3:134528733-134528755 TAGCAAAGACAGAAGAAAAAAGG - Intronic
964261464 3:154842891-154842913 TAGAAGAGACAGCTGAATCAGGG - Intergenic
964975036 3:162607612-162607634 TTGAATACACAGATGCACAGAGG - Intergenic
965308735 3:167101471-167101493 TACAAGAGAAAGATGAAAAATGG - Intergenic
965978289 3:174653279-174653301 TAGAATGGATAAATGAATAATGG + Intronic
967379590 3:188842862-188842884 TTGAATAGAAAGAGGAATAAGGG - Intronic
969964674 4:10982062-10982084 TTGAATAAATAGATGAACAAAGG - Intergenic
970124125 4:12790225-12790247 TAGAATAAAAAGATGAACAAAGG - Intergenic
970258817 4:14201136-14201158 GAGAATAGAAAAATGACCAATGG - Intergenic
973712886 4:53646725-53646747 GAGAATAGAAAGTAGAACAATGG - Intronic
974336176 4:60547999-60548021 AACAATAGACGAATGAACAATGG + Intergenic
974684101 4:65201754-65201776 TAGATTATAAAGATGAAAAATGG - Intergenic
974778604 4:66521872-66521894 TAGAATAGATATATGTATAAAGG + Intergenic
976066919 4:81198313-81198335 AAGAAAAGACAGAGGCACAAAGG + Intronic
976470533 4:85423605-85423627 TTGAATTGATAGATGAATAATGG - Intergenic
976729371 4:88246337-88246359 AAGGATACACTGATGAACAAAGG - Intergenic
977689574 4:99891740-99891762 TAGAAGAAACAGATGACCAAGGG + Intronic
978435740 4:108682376-108682398 AAGAAGAGACAGATGAACTAAGG + Intergenic
978514132 4:109553312-109553334 TAGAAGACACTGATGAAGAAGGG - Intergenic
978933689 4:114349667-114349689 TAGAAAAAACAGATTAAAAATGG + Intergenic
978966959 4:114751717-114751739 TGGAATAGACATATGTATAAAGG - Intergenic
979932819 4:126653480-126653502 TAGAAGTGACAGATGATGAAGGG - Intergenic
980161239 4:129165842-129165864 TAGAATAGAGAAAAGAACAGAGG + Intergenic
980879393 4:138694233-138694255 TATAATAGAAAAATGAATAAAGG - Intergenic
982094104 4:151905315-151905337 TGGAATAGAAAGAGGAAGAAGGG + Intergenic
983858446 4:172674667-172674689 TAGAACAGAGAGAGGAAAAAAGG - Intronic
983982758 4:174019031-174019053 AAGAAATGACAGAGGAACAAAGG - Intergenic
985203616 4:187508752-187508774 TGGAAGAGACAGAGGAAGAAAGG - Intergenic
985709249 5:1419062-1419084 TAGGATGGACAGATGGATAATGG - Intronic
986054719 5:4125061-4125083 AATAATAAAAAGATGAACAAAGG + Intergenic
986142143 5:5040832-5040854 TCGAAAAGACAGTTGGACAAAGG + Intergenic
986896912 5:12382411-12382433 TAGCAAAGACACTTGAACAATGG - Intergenic
986975724 5:13391175-13391197 TAAAATACAAATATGAACAAAGG + Intergenic
987539468 5:19235351-19235373 TAGAATAGATATATGTATAAAGG - Intergenic
989512597 5:42305560-42305582 AAGAATAGTCAGATAAACAGTGG + Intergenic
990054910 5:51561758-51561780 TAGAATAGAAAGATAGAAAATGG - Intergenic
990392691 5:55342805-55342827 TAAAATAGACAAATCAACAAAGG - Intronic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
990712327 5:58598982-58599004 AAGAATAGCGAGATGAGCAAAGG - Intronic
990863565 5:60355233-60355255 TATAATAGTCAGGTGACCAAAGG - Intronic
990896621 5:60706744-60706766 AAGAATAGAGAGAGGAACAGAGG + Intergenic
991509171 5:67357871-67357893 TAGAAGAGAGATCTGAACAAAGG - Intergenic
991571301 5:68056016-68056038 TAGAATAGTCAATTGAAAAATGG - Intergenic
993136435 5:83971981-83972003 TATAATAGAGAAATAAACAATGG - Intronic
995101232 5:108308834-108308856 TAGAATAGACACAAGGAAAAGGG + Intronic
995217550 5:109612961-109612983 TAGAAAATACAGATGAATAAAGG - Intergenic
995517294 5:112966856-112966878 TAGCAGAGACAGATGAAGATGGG + Intergenic
997708301 5:135979677-135979699 TAGCATACACAGTTGGACAACGG + Intergenic
998563468 5:143193968-143193990 TAGACTCCACAGATGAACAAGGG + Intronic
999190454 5:149743135-149743157 AAGAATAAACACATAAACAAAGG - Intronic
999402771 5:151279480-151279502 TAGAATTGATGGATGAATAATGG + Intronic
999842516 5:155444219-155444241 TAGAACAGAAAAATCAACAAGGG + Intergenic
999861283 5:155649353-155649375 GAGAATAAATAAATGAACAACGG + Intergenic
1000096421 5:157974654-157974676 TAGAATAGACGCATGCACATAGG + Intergenic
1000325299 5:160167571-160167593 TTGAATTGACAGATGAATGAAGG - Intergenic
1000572637 5:162934885-162934907 TATAAAAGACAAATGAAAAATGG - Intergenic
1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG + Intergenic
1001754193 5:174155313-174155335 TAGAAAAGAAAAATCAACAATGG - Intronic
1002337546 5:178490387-178490409 TAGAATGGACAGATTTACAGAGG + Intronic
1003843965 6:10153475-10153497 TAAAATAAACTGAAGAACAAAGG + Intronic
1007866816 6:44980201-44980223 TAAAATAGACAAATGCAGAAAGG + Intronic
1008074887 6:47135059-47135081 CAAAATAGACACATGAAGAAGGG - Intergenic
1009541590 6:64966916-64966938 GAGAGTAGCCAGATGATCAAAGG - Intronic
1010451659 6:76010835-76010857 CAGTAGAGACAGATGAAAAAAGG - Intronic
1010654306 6:78494150-78494172 AAGAATGGACAGATCCACAAGGG - Intergenic
1012140425 6:95620119-95620141 AAGAATATACTGAAGAACAAAGG + Intergenic
1012496374 6:99837780-99837802 TAGAAAAGAGAGATGACAAAAGG - Intergenic
1012857886 6:104524903-104524925 AAGTATAGACAGATCAACAATGG + Intergenic
1014042282 6:116842511-116842533 TGGAAAACACAGATGATCAAAGG + Intergenic
1015522382 6:134144749-134144771 TAGATTAGAGATATGATCAAAGG + Intergenic
1015641868 6:135343076-135343098 TAGAATATACAGATTCAAAAAGG + Intronic
1015725786 6:136297981-136298003 TAGAAAATACAGAAGAGCAAAGG - Intergenic
1015745117 6:136501745-136501767 GAGAATAGACAGATCCACCATGG + Intronic
1015759919 6:136647748-136647770 TAGAAGAGATAAATGAACACGGG - Intronic
1016343677 6:143087841-143087863 TAGAATAGATAGAAAAATAATGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017056551 6:150441814-150441836 TATAGTTGACAGTTGAACAATGG - Intergenic
1018148640 6:160918146-160918168 AAGAAAAGAAAGATGAAGAAAGG + Intergenic
1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG + Intergenic
1020449377 7:8304217-8304239 TAGACTAGATACATGAACATGGG - Intergenic
1020452152 7:8332374-8332396 CATAATAGACAGATCAACACAGG - Intergenic
1020718735 7:11713954-11713976 TAGAATAGAAAGGTAAAGAAAGG + Intronic
1021226120 7:18028187-18028209 TAAAATAGAAAGTTGAAAAATGG + Intergenic
1021501118 7:21333152-21333174 TAAAAACAACAGATGAACAATGG + Intergenic
1022461257 7:30609997-30610019 TAGAAGGGACAGTTGAAGAATGG + Intronic
1022701788 7:32768140-32768162 TAGAATAGATAAATAAACTATGG + Intergenic
1023497229 7:40810706-40810728 CAGAATAAACAGATGACCTATGG - Intronic
1023596121 7:41830725-41830747 TAGAATAGTGAGTTGAATAATGG + Intergenic
1023693701 7:42822911-42822933 TAGAATGCAAAAATGAACAATGG - Intergenic
1023969602 7:44981184-44981206 TAGAACAGGTAGATGAACAAAGG + Intergenic
1024232896 7:47376250-47376272 CCGAATAGACAGATCAACAGAGG + Intronic
1027536836 7:79413885-79413907 TGGAATAAACAGATGAATAATGG - Intronic
1028317378 7:89420368-89420390 TAATACAGACAGATGAAAAAAGG + Intergenic
1028799877 7:94950467-94950489 TAAATTACACAGAAGAACAAAGG - Intronic
1028875925 7:95823386-95823408 TAGGAAAGACAGATTAAGAATGG - Intronic
1030318899 7:108144088-108144110 TAGAAAAGACAGAAGGCCAAAGG + Intergenic
1030359090 7:108576539-108576561 CAGAATAGACAGAGGGGCAATGG + Intergenic
1030419935 7:109296210-109296232 ATGAATAGACAGTTGACCAAGGG + Intergenic
1030634675 7:111935430-111935452 GTGAATAGACAGAAAAACAAAGG + Intronic
1030668541 7:112308760-112308782 AACAAAAGACAGATTAACAAAGG + Intronic
1031274244 7:119697750-119697772 TAGAATGGAAGGATAAACAATGG + Intergenic
1033786844 7:144742241-144742263 CAGAAATGACAGATGATCAATGG - Intronic
1033885681 7:145942473-145942495 AAGAAAAGAGAGATAAACAAGGG + Intergenic
1034127880 7:148690222-148690244 TATAAGAGACAGAAAAACAAAGG + Intergenic
1036010381 8:4715407-4715429 TAGAAAACAGAGATGAATAAAGG - Intronic
1036193792 8:6696453-6696475 TAGAATAGACATATGAAGAAAGG - Intergenic
1036990549 8:13588180-13588202 CAGAGAAAACAGATGAACAATGG + Intergenic
1037084102 8:14825733-14825755 TAGAATAGACGGTAGAACAGTGG - Intronic
1038905691 8:31899714-31899736 TAGAAAAGAAATATGAATAATGG + Intronic
1039261367 8:35775368-35775390 TAGAATAGAGAGATCCATAATGG + Intronic
1039928386 8:41960091-41960113 TAGAGTAGACAAATTAATAAAGG + Intronic
1040744687 8:50627156-50627178 TAAAATACAAAGATGAGCAATGG - Intronic
1040819771 8:51542853-51542875 TAAACTAGACAGATCAACAAAGG + Intronic
1041959374 8:63594920-63594942 TAGAATAGATAGTTGGATAAAGG + Intergenic
1042323754 8:67506353-67506375 AACAATAAAGAGATGAACAAGGG - Intronic
1043573897 8:81634499-81634521 TGGAAAAGACAGCTGAATAATGG + Intergenic
1043579334 8:81693806-81693828 TGGAAAAGACAGCTGAATAACGG + Exonic
1044377354 8:91491895-91491917 TAGAAAGGCCAGATGAAGAAAGG - Intergenic
1045079558 8:98610475-98610497 TAGAATAGAAAGAAAATCAATGG - Intronic
1045288705 8:100813449-100813471 TATAACAGACAGGTTAACAAGGG - Intergenic
1045713346 8:105012061-105012083 TAGAATAGAGAGGTGGAAAATGG - Intronic
1046700895 8:117400132-117400154 TGGTATAGAAATATGAACAATGG + Intergenic
1046793468 8:118346033-118346055 CAGAATAAACAGATGCACCAAGG - Intronic
1047033017 8:120904117-120904139 GAGTATACACAGATGAATAAGGG + Intergenic
1047568830 8:126075264-126075286 TAGAATAGATAGATGATAGAAGG - Intergenic
1047906415 8:129477744-129477766 CAGAATTCACAGTTGAACAAAGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050024229 9:1317166-1317188 TAGAATAGAGAGATCATAAATGG + Intergenic
1050458181 9:5853924-5853946 GACAAAAGACAGATGAACAGAGG + Intergenic
1050820942 9:9879191-9879213 TAGAATAAACAAAAGAAAAAAGG - Intronic
1052224143 9:26064084-26064106 TAGAATACACAGGAAAACAAGGG + Intergenic
1053594424 9:39545498-39545520 GACAATAGACAGATTAACAAGGG + Intergenic
1053852205 9:42300531-42300553 GACAATAGACAGATTAACAAGGG + Intergenic
1054571833 9:66819469-66819491 GACAATAGACAGATTAACAAGGG - Intergenic
1055175166 9:73310098-73310120 TAGTAGAGGCAGATGAACACTGG - Intergenic
1055673493 9:78631303-78631325 GAGAATAGAAAAAAGAACAAGGG + Intergenic
1056172665 9:84002455-84002477 TAGAACAGACAAATAGACAAAGG - Exonic
1056971243 9:91205842-91205864 TAGGACAGACAGAAGATCAATGG + Intergenic
1057484656 9:95473038-95473060 TAGACCAGACAGAACAACAAGGG + Intronic
1057834851 9:98436093-98436115 TAGAATAAATGAATGAACAAAGG + Intronic
1057926953 9:99161077-99161099 GAGAATAAACAAATGAATAAAGG - Intergenic
1058331154 9:103762396-103762418 AACAAAAGACAGATTAACAAGGG - Intergenic
1059064285 9:111066356-111066378 GAGAAAAGAGAGATGAAGAAAGG - Intergenic
1059085236 9:111294311-111294333 TATATTATACAGATGAACAGTGG - Intergenic
1059215791 9:112560919-112560941 AAGAATTCACAGATGAAGAAGGG - Intronic
1059263347 9:113001395-113001417 CAGAATGGAAAGATTAACAATGG + Intergenic
1203723613 Un_GL000216v2:31698-31720 TTGAATAGACACAAAAACAATGG - Intergenic
1185622382 X:1460137-1460159 TAGAATAGATAGATGATAAATGG - Intergenic
1185813569 X:3132712-3132734 TATAAGAGACAGAAGAGCAATGG - Intergenic
1185954816 X:4478071-4478093 AAGAAGAGACAGATGAAGAAAGG + Intergenic
1188262348 X:28035924-28035946 TAGAATAGACTGAGGAAGAAAGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1189578555 X:42381798-42381820 TAGAAGAGACAGATAAAGCAAGG - Intergenic
1192339879 X:70255174-70255196 ATCAATAGTCAGATGAACAAAGG + Intergenic
1193535951 X:82715542-82715564 TACAGTGGACAGATAAACAAGGG + Intergenic
1193571015 X:83143436-83143458 TCAAATAGACAGTTGAACACCGG + Intergenic
1193761716 X:85475308-85475330 TAGAATAGACAAAGGAAGTATGG + Intergenic
1194128048 X:90044683-90044705 AACAAAAGACAGATTAACAATGG + Intergenic
1194854949 X:98916735-98916757 AAGAATAGACATATAGACAAAGG - Intergenic
1194890084 X:99367710-99367732 TAGAATATGCAGATTAACTAAGG - Intergenic
1196190314 X:112787908-112787930 TAGAAAAGAAAGAAGAAAAATGG - Intronic
1197306724 X:124851536-124851558 TAGAATAGTGAGATGGACATTGG - Intronic
1197846852 X:130812109-130812131 TAGAAGAGAAAGATGACAAAGGG + Intronic
1198077241 X:133205348-133205370 TAGAATGGACTGAAGAACAGAGG + Intergenic
1199268617 X:145856843-145856865 TAGATTAGACAGAGCAAAAAGGG + Intergenic
1199488460 X:148373213-148373235 TAGAAAATCCAGATGAAGAATGG - Intergenic
1199951471 X:152709543-152709565 AAGAATGGACAGATTAATAAAGG - Intergenic
1199958212 X:152758917-152758939 AAGAATGGACAGATTAATAAAGG + Intergenic
1201268041 Y:12227828-12227850 TAAAAGAGACAGAAGAGCAATGG + Intergenic
1202112929 Y:21443401-21443423 TAGAAAAGACAGATGGATACTGG + Intergenic