ID: 1106866309

View in Genome Browser
Species Human (GRCh38)
Location 13:33967994-33968016
Sequence GTGAATTTACAGAAAGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 471}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106866309 Original CRISPR GTGAATTTACAGAAAGACAA AGG Intergenic
900498984 1:2990435-2990457 GGGAATTTTCAGAAAGCCAGGGG + Intergenic
901534639 1:9874239-9874261 GTGCCTTTACACCAAGACAAAGG - Intronic
902879950 1:19365420-19365442 GTGGATTTCCAGAAAGAGCACGG + Intronic
906245222 1:44268649-44268671 GTCAACTCACAGAAAGACCATGG + Intronic
906333664 1:44909280-44909302 GTGAGTTTTCAGAAAGAGGATGG - Intronic
907619175 1:55958860-55958882 GGGTATTTACAGAAAAAAAAAGG - Intergenic
907898704 1:58717764-58717786 GTGGATTCTCAGAAAGAAAAAGG + Intergenic
908103027 1:60810845-60810867 GTTAATTTGCAGAAATACAGAGG - Intergenic
908481524 1:64544855-64544877 CTGAATTTTCAGCAAGAAAAGGG - Intronic
909540016 1:76780801-76780823 GTGCATTTTCATAAAGTCAAGGG - Intergenic
910355520 1:86349205-86349227 GTGAATTTTTAGACAGAAAATGG - Exonic
912065661 1:105738109-105738131 GTGAATGTATAAAAAGACTATGG - Intergenic
913150698 1:116039662-116039684 ATGAATTAAATGAAAGACAATGG - Intronic
913173836 1:116256200-116256222 GTGAATTGAAAGAAAGAACAAGG - Intergenic
915816543 1:158973067-158973089 GTCAACTTAGAGAAAGAAAAGGG + Intronic
915828535 1:159103816-159103838 GTGATTTGTCAGAAAGAGAAAGG - Intronic
916908844 1:169321711-169321733 GTGCTTATACAGAAAGACTATGG + Intronic
917672584 1:177287091-177287113 GTAAATGTTCAGAAAGAGAAGGG - Intergenic
918969961 1:191401170-191401192 GGGAATTTACAGGAAAACAAAGG + Intergenic
919610161 1:199735521-199735543 GGTAATTTACAGCAAGAGAAGGG + Intergenic
920114574 1:203611126-203611148 GTGATTTTACACAAAAGCAAAGG - Intergenic
921207680 1:212862368-212862390 GTCAATCCACAGAAAGAGAAGGG - Intronic
922635421 1:227165235-227165257 GTGAATGTAAGAAAAGACAATGG + Intronic
923063773 1:230499808-230499830 GTGAATATACTAAAAGTCAATGG - Intergenic
923141718 1:231165498-231165520 GTGAATTTGCAGAAAGCTACAGG + Intronic
924641152 1:245834973-245834995 GTGAACTTACAGATACATAAGGG + Intronic
924888344 1:248244835-248244857 GTAAATTAACAGAAATACAATGG - Intergenic
1063571802 10:7221987-7222009 GAGAATATAAAGAAAGATAAAGG - Intronic
1063862193 10:10323127-10323149 GGGAATTTAGAGAAAGACAATGG + Intergenic
1064494006 10:15888435-15888457 GTGTATTTCCAGAAATACAGAGG - Intergenic
1065251103 10:23815319-23815341 GTTACTCTACAGAAAGACAGTGG + Intronic
1065871381 10:29959150-29959172 GTGAAGATACAGCAAGAAAACGG + Intergenic
1067265433 10:44738363-44738385 CTGACTTTACAGAAATAAAAAGG + Intergenic
1067657690 10:48209376-48209398 GTGAATCTACAGACAGACTATGG + Intronic
1067725270 10:48765737-48765759 GAGAGGTTACAGAAAGGCAATGG + Intronic
1067990144 10:51202630-51202652 GTGAGTTAAAAGAAATACAAGGG + Intronic
1068950540 10:62772556-62772578 CAGAATTTACAGAAACAAAAAGG + Intergenic
1069287369 10:66732284-66732306 GTCAATTTACAGAGAGAGAGAGG - Intronic
1070485575 10:76927523-76927545 GAGTAATTAAAGAAAGACAATGG + Intronic
1071280685 10:84099886-84099908 GTGAAGTTGCAGAAGGTCAAGGG - Intergenic
1071460583 10:85890429-85890451 GTCAATTTAAAAAAAGAAAATGG + Intronic
1072008292 10:91278439-91278461 GACAATTTAGAGATAGACAATGG - Exonic
1073107119 10:101038618-101038640 GTGGAGAGACAGAAAGACAATGG - Intronic
1074578684 10:114695483-114695505 TTGAATTTGTAGAAAGAGAATGG - Intergenic
1075361904 10:121845739-121845761 GGGAATTTACAGATAAGCAAGGG + Intronic
1078178273 11:8987320-8987342 GGGAGTTAACAGAAAGCCAAAGG + Intronic
1079158658 11:17972991-17973013 GTGAAGTTACAAAAAAAAAAAGG + Intronic
1079914462 11:26351585-26351607 GAGAATTTATAGACAGAAAAAGG + Intronic
1079917844 11:26393040-26393062 GTTAATATGCAGAAAGGCAAAGG + Intronic
1081217384 11:40418201-40418223 ATCTATTTATAGAAAGACAAAGG + Intronic
1082706727 11:56501512-56501534 GGGAATGAAAAGAAAGACAAAGG - Intergenic
1083500494 11:63102964-63102986 GTCAATTTATACAAACACAAAGG + Intronic
1084736861 11:71110988-71111010 GTGAAGACACAGCAAGACAATGG + Intronic
1084896974 11:72279550-72279572 GTGACTCTACAGAAATAAAAAGG - Intergenic
1084969286 11:72761418-72761440 GAAAATTTACAGAAACAAAATGG + Intronic
1085756834 11:79208872-79208894 GGGAATTTTCACAAAGGCAATGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086525224 11:87716830-87716852 GTGAGATTAGAGAAAGATAAGGG - Intergenic
1086891421 11:92262639-92262661 AGTAATTTACAGAAAGAAAATGG + Intergenic
1087833893 11:102850585-102850607 GTGATATTACAGACAGAAAAAGG + Intergenic
1088570116 11:111214621-111214643 GAGAATGTAGAGAAAGACATAGG + Intergenic
1088840353 11:113622428-113622450 GTGAAATTGGAGAAAGACAGGGG + Intergenic
1089905150 11:122030883-122030905 GTGAATTGAGAGAATGACATAGG + Intergenic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1090093798 11:123724377-123724399 GTATATTTCCAGAAGGACAACGG + Exonic
1090112655 11:123931356-123931378 GTGAATTTACAGACAAGCAATGG - Intergenic
1092405016 12:8215132-8215154 CTGAATTTAAAGAAAGAAAAAGG + Intergenic
1093214249 12:16345031-16345053 GTGGATTTAGGGAAAAACAAAGG + Intergenic
1093575050 12:20717593-20717615 GGGACTTGACAGAAAGACCAAGG + Intronic
1094336401 12:29360767-29360789 ATTAGTTTACAGAAAGAGAAGGG + Intronic
1094350876 12:29523307-29523329 GAGGATTTACAGACAGAAAAAGG + Intronic
1095600191 12:44004444-44004466 ATGGATTTACACAAAGAGAATGG + Intronic
1098703151 12:73653963-73653985 TTGAAGTTATAGAAAGAAAAAGG - Intergenic
1099115170 12:78614812-78614834 GTGGATTTTCAGAAACACCATGG - Intergenic
1099673327 12:85723483-85723505 GTTAATTTAATGAAAGATAAGGG - Intergenic
1099735068 12:86556718-86556740 GTGACTTAAAAGAAAAACAATGG - Intronic
1100593584 12:96052421-96052443 GTGAATTTTGAGAGGGACAAAGG + Intergenic
1101441717 12:104708951-104708973 GTGAATGTAGGGAAAGAGAAAGG + Intronic
1101783099 12:107854451-107854473 TTGAATTTAGTGAAAGAAAAGGG + Intergenic
1103094302 12:118120551-118120573 TTGAGATTACAGAAAGACAGGGG + Intronic
1104660891 12:130610858-130610880 GTGAATTTAAAGCAGGAAAATGG - Intronic
1105484572 13:20814432-20814454 GGCAATTTACAGTAAGACTATGG + Intronic
1105682827 13:22746644-22746666 GTGGATTCTCTGAAAGACAATGG + Intergenic
1106200684 13:27534440-27534462 GTGAAATAAAAGAAAGAAAATGG + Intergenic
1106238962 13:27892775-27892797 CTGATTTTACAGAAATAAAAAGG - Intergenic
1106539448 13:30676695-30676717 GTGGAGTTACAGAAAAATAAAGG - Intergenic
1106866309 13:33967994-33968016 GTGAATTTACAGAAAGACAAAGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107687216 13:42914648-42914670 GCAAATTTAAAAAAAGACAAAGG - Intronic
1108202100 13:48054517-48054539 GTGAATTTAAAAAAAGAAATGGG - Intronic
1109129068 13:58557641-58557663 GTGGAGTAACAGAAAGAAAATGG - Intergenic
1109638531 13:65154869-65154891 GTCAATTCACAAAGAGACAAAGG - Intergenic
1109794446 13:67291487-67291509 ATGAATGTTCAGTAAGACAAAGG + Intergenic
1110719172 13:78742289-78742311 GTAAAATTACAAAAAGAGAAAGG + Intergenic
1110957163 13:81568616-81568638 GTGCATTTCCAGAGAGAAAATGG + Intergenic
1111010627 13:82309759-82309781 CTGAATCAACAGAAATACAAAGG - Intergenic
1111279676 13:86004861-86004883 ATGAATTTCCAGAAAAATAAGGG + Intergenic
1111365836 13:87243703-87243725 GTGAATATAGATAAATACAATGG + Intergenic
1112526643 13:100154718-100154740 GTGATTTTACATAAAGAGATAGG + Intronic
1114732088 14:25003816-25003838 ATGAATTGACAGCAACACAATGG + Intronic
1115469569 14:33754619-33754641 CTGAATTTCCAGAAAGACAGAGG + Intronic
1115791910 14:36889379-36889401 AAGAAATTACAGAAATACAAAGG + Intronic
1115824091 14:37245743-37245765 TTCAAATTACAGAAAGGCAATGG + Intronic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116466903 14:45244503-45244525 ATGAAGTGACAGAAGGACAAAGG - Intronic
1116528817 14:45941031-45941053 GTGAATACACAGCAAGAAAAAGG - Intergenic
1116981200 14:51172585-51172607 GTGAATTCACAGAGATAGAAAGG - Intergenic
1117122976 14:52588624-52588646 GTGAATATCATGAAAGACAAAGG + Intronic
1117267554 14:54105670-54105692 CTGAATTTTCAGAAAAAAAAAGG - Intergenic
1118125228 14:62894786-62894808 GTGCATTTAATGAAAGTCAAAGG - Intronic
1118472226 14:66085071-66085093 GGGAATTTACAGATAAGCAAGGG + Intergenic
1119552778 14:75527488-75527510 TTGAATTTACAGGGAGACAGGGG - Intronic
1119946027 14:78695370-78695392 TTGAATCTACAAAAAGAGAAAGG - Intronic
1120127691 14:80765443-80765465 CTGAATTGACTGAAAGACCAGGG - Intronic
1120220438 14:81726086-81726108 GGGAAATAACAGAAAGAAAAGGG - Intergenic
1120351178 14:83360704-83360726 GAGAATAAACATAAAGACAATGG - Intergenic
1120504799 14:85341983-85342005 GAGAAATTACAGAAAAATAAGGG + Intergenic
1124131290 15:26988961-26988983 GTGAATATACTGAAAGCCATTGG - Intronic
1124162859 15:27289718-27289740 GAGAGTTTACAGATAAACAAGGG + Intronic
1124173002 15:27393585-27393607 GAGAGTTTACAGATAAACAAGGG - Intronic
1124454737 15:29831464-29831486 GTGCATAAACAGAAATACAAGGG + Intronic
1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG + Intronic
1124969119 15:34467634-34467656 GGGAATTTAGAGACAGACACAGG + Intergenic
1125097000 15:35866352-35866374 TGGATTTCACAGAAAGACAAAGG + Intergenic
1126511262 15:49477486-49477508 GTGAAGCCACAAAAAGACAAGGG - Intronic
1126983021 15:54268188-54268210 GTGAATTTAAACACACACAATGG - Intronic
1127888679 15:63227804-63227826 GTGAATTCCCACACAGACAAAGG - Intronic
1128631005 15:69267282-69267304 GAGGATTTTAAGAAAGACAATGG - Intronic
1128775541 15:70317299-70317321 GAGAATTTACACAAAGCCATCGG - Intergenic
1129012793 15:72438291-72438313 GTGAATGTGAAGAAGGACAATGG - Intergenic
1129146411 15:73651718-73651740 AGGAATTTTCAGACAGACAAAGG - Intergenic
1129395609 15:75243963-75243985 GTAAAATTGCAGAAAGCCAAAGG + Intergenic
1130410182 15:83640695-83640717 TTGAAATTATAGAAATACAAAGG - Intergenic
1130673664 15:85934169-85934191 GTGTATTTGCTGAAAAACAATGG + Intergenic
1130803240 15:87289548-87289570 GTGTATTTTTAGAAAAACAAAGG - Intergenic
1131899829 15:97075398-97075420 ATGAAGATACAGAAAGGCAATGG - Intergenic
1131915392 15:97259869-97259891 GTGGATTTACAGCAAGGTAAGGG + Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133099590 16:3471063-3471085 GTGAATTTCAAGAAAAACACTGG - Intronic
1133444739 16:5850307-5850329 GTGACCTTCCAGAAAGAAAATGG + Intergenic
1133866143 16:9645277-9645299 CTGAATTTACAGATAGGAAATGG - Intergenic
1135170447 16:20178991-20179013 GTGAAATTTGAGGAAGACAAGGG - Intergenic
1135301905 16:21336500-21336522 ATGATTTTACAGAAATAAAAAGG - Intergenic
1135820730 16:25683214-25683236 GTGACCTTACAAGAAGACAAAGG + Intergenic
1135896708 16:26412114-26412136 GGGAATTTACAGATCAACAAAGG + Intergenic
1136033788 16:27522885-27522907 GTGGGTCTACAGAAACACAATGG + Intronic
1138347604 16:56329627-56329649 GTGCATTTCCCGAAAGCCAAGGG - Intronic
1139248077 16:65467517-65467539 GTGAATTTAGAAAAAGTCACAGG + Intergenic
1139531205 16:67543548-67543570 GTGAATTGGGAGAAAGTCAAAGG + Intronic
1140030517 16:71334540-71334562 GTGATTTTAAAGGAAGACAAGGG - Intergenic
1140499980 16:75425571-75425593 TTCACTTTACAGAAATACAAAGG + Intronic
1140728926 16:77838680-77838702 GGAAATGGACAGAAAGACAAAGG - Intronic
1141903209 16:87006271-87006293 GTGACTTCACAGAAAAACCACGG - Intergenic
1143295512 17:5868796-5868818 GGGAATGTCCAGAAAGACAGTGG + Intronic
1143742154 17:8962311-8962333 ATGAATGTACAAAAAGACACAGG + Intronic
1144127411 17:12215913-12215935 GTGTATTCATAGAAACACAAAGG - Intergenic
1146679334 17:34795912-34795934 GTGCCTTTACTGAAGGACAAGGG - Intergenic
1148656957 17:49291862-49291884 GTGAGTTTACAAAATGAAAAAGG - Intronic
1148821884 17:50364631-50364653 GAGATTTTACAGAGACACAAAGG - Intergenic
1149288460 17:55192163-55192185 GTGAATTGATAAAAAGACAAAGG + Intergenic
1149442751 17:56688952-56688974 GTGAAGTTACAGAAAGAACAAGG + Intergenic
1149673348 17:58435246-58435268 GTGAATTTAAAGTGAGACTAAGG + Intronic
1149983301 17:61328842-61328864 GTGAAGGCACAGAAAGACGATGG - Intronic
1150314991 17:64161394-64161416 GAGAATTTTAAGAAAGACAGCGG - Intronic
1151142641 17:72009144-72009166 GGGAATTCACAGAAAGACCGTGG + Intergenic
1153550138 18:6253764-6253786 GTCTATTTACTGCAAGACAATGG + Intronic
1154488189 18:14895706-14895728 GTGAAGCCACAAAAAGACAAGGG + Intergenic
1154970275 18:21401330-21401352 GTCAATTTCCAGGAAGAAAAGGG + Intronic
1155398161 18:25408273-25408295 GGGAATTTACAGATAAGCAAGGG - Intergenic
1155760862 18:29564811-29564833 GTGACCTTACAGAAATAAAAAGG + Intergenic
1157165175 18:45352227-45352249 GTAAATTTTCAGAGAGACCATGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158254087 18:55526143-55526165 ATGTATTTACAGAACCACAAAGG + Intronic
1159262194 18:66028633-66028655 GGGAATTGACAGATGGACAAAGG + Intergenic
1159386898 18:67737944-67737966 GTGACTTTACATAACCACAAAGG - Intergenic
1160343027 18:78105939-78105961 GTGAATTTGCAGAAAATCATGGG - Intergenic
1160589222 18:79932640-79932662 ATGACTTTCCAGAAATACAAAGG + Intronic
1164255828 19:23527410-23527432 GTAAATTGAGAAAAAGACAAGGG - Intronic
1165009847 19:32836901-32836923 ATGAATATACAGAAAAACAGGGG - Intronic
1166030299 19:40120331-40120353 GTGGTTTTACAGACAGAAAAGGG + Intergenic
925520777 2:4742469-4742491 GGGAATTTATAGATACACAAAGG + Intergenic
926557433 2:14375538-14375560 CTGAATTTATTGAAGGACAATGG + Intergenic
926573487 2:14555079-14555101 GTGCATTTACAGAAAGTCTGGGG + Intergenic
926777166 2:16434105-16434127 GTGAAATAAGAGAAAGTCAAAGG - Intergenic
927670585 2:25065708-25065730 GTGAATTTCCAGAAGAAAAATGG - Intronic
928048517 2:27964317-27964339 GGGAATTTATATAAAGAAAAAGG - Intronic
928351039 2:30555351-30555373 GAGAACTAACAGAAAGACATAGG + Intronic
930508684 2:52317381-52317403 TTGAAGTTACAGAAAGAATAAGG - Intergenic
931078025 2:58738253-58738275 GTGTACATACAGAATGACAAAGG - Intergenic
932280969 2:70491553-70491575 TTGAATTTTCAAAAAGATAAAGG - Intronic
933402292 2:81813773-81813795 GGGGATTTATAGAAAGAAAATGG - Intergenic
934054925 2:88243625-88243647 GAAAATTTACAGCATGACAATGG + Intergenic
935167376 2:100581211-100581233 ATGAAGTTACTGAAAGGCAATGG - Intergenic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
936250774 2:110866710-110866732 GTGAATACAGAGACAGACAAAGG - Intronic
936292235 2:111235172-111235194 CTGAATTTACAAAAAGCCTAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938151361 2:128887657-128887679 TTGACTTTACAGAAATAAAAAGG - Intergenic
938823472 2:134981616-134981638 ATCAACTTAGAGAAAGACAAGGG - Intronic
939669445 2:144992149-144992171 TAGAATTTAGAGAAGGACAACGG - Intergenic
940109615 2:150137071-150137093 TAGGATTTACAGAAATACAAGGG - Intergenic
940446332 2:153782666-153782688 GTGAAGGTATAGGAAGACAATGG + Intergenic
940695263 2:156969184-156969206 GTATATTTACAAAAAGAAAAAGG - Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
943044993 2:182849931-182849953 GTCAATTAACAAAAAGAAAAGGG + Intronic
943082844 2:183277207-183277229 GTTAATCCACAGAAAGTCAAAGG + Intergenic
943199591 2:184803370-184803392 GTGAATATAAAGGAAGGCAAGGG - Intronic
943394924 2:187322303-187322325 GTGGACTTACATAAACACAAGGG - Intergenic
944052167 2:195482535-195482557 GAGAATTTACAGGAAGAATATGG + Intergenic
945230259 2:207581047-207581069 GTAAAGTTACATAAAGGCAAAGG - Intronic
945404613 2:209429429-209429451 GTTAACTAACATAAAGACAATGG - Intronic
945700641 2:213166020-213166042 TTGAATTTAGAAAAAGAGAAAGG - Intergenic
945746562 2:213725614-213725636 GGGAATTTACATAAAGAAGAGGG + Intronic
946028291 2:216685721-216685743 GTGCATTTGCAGAAGGAGAAAGG + Intronic
946547611 2:220762049-220762071 GTCAATTTGAAGATAGACAATGG - Intergenic
946965070 2:225028606-225028628 GTGACTTTGCAGAGATACAAAGG - Intronic
947846678 2:233250348-233250370 GTGAATTTACTGCATGAAAATGG - Intronic
948127532 2:235575808-235575830 GTTATTTTACGGAAAGAAAAAGG - Intronic
1169740488 20:8888477-8888499 GTGATTTAAGAGAAAGAGAAAGG - Intronic
1169859630 20:10137701-10137723 TTGAATTAGCAGAAAGACAAGGG + Intergenic
1170137656 20:13092744-13092766 GTGAAACTACAGAAATATAATGG + Intronic
1170723953 20:18909052-18909074 TTGAATTCACAGCAAGATAATGG - Intergenic
1173386490 20:42593071-42593093 GTGAATGCACAGAAAGGCAGAGG + Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174993771 20:55543029-55543051 CTGCATTTGCAGAAAGACAAGGG + Intergenic
1175358829 20:58390921-58390943 CTGAATTTACAGAGAACCAAAGG + Intronic
1175659537 20:60800529-60800551 GAAAATTTACAGAAAAGCAAGGG + Intergenic
1175669746 20:60891955-60891977 GGGAATTTACAGAATGGCATTGG - Intergenic
1176793085 21:13343627-13343649 GTGAAGCCACAAAAAGACAAGGG - Intergenic
1176978863 21:15355685-15355707 TTAAATTTACCGAAAGTCAAGGG - Intergenic
1177750403 21:25275974-25275996 GTGAAATAACAGATAGAAAATGG - Intergenic
1177902136 21:26929849-26929871 TTCAATTCACATAAAGACAAAGG + Intronic
1178136090 21:29629398-29629420 GTGATTTTGGAGAAAGAGAATGG + Intronic
1178189948 21:30268826-30268848 GTGACATTACAGAAACAGAAAGG - Intergenic
1180912235 22:19459203-19459225 GTAAATTTACAGTTATACAATGG + Intronic
1184805105 22:46790017-46790039 GAGCAGTCACAGAAAGACAATGG - Intronic
1185283399 22:49986988-49987010 CTGATTTTACAGAAATAAAAAGG - Intergenic
949480674 3:4491945-4491967 GTGGATTTCCCCAAAGACAAGGG + Intergenic
950724091 3:14905050-14905072 GAGAATTTACAGATAAGCAAGGG - Intronic
950818736 3:15734974-15734996 GTAAATTTATAGAAAGAAACTGG - Intronic
951289812 3:20862139-20862161 GAGAATTTCGACAAAGACAATGG - Intergenic
951732181 3:25822449-25822471 ATCCATTTACAGAAAGAAAATGG + Intergenic
952014974 3:28945670-28945692 GGGAATTTACAGACAAGCAAGGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953259536 3:41324120-41324142 GTGAATTGAAAGGAAGAGAATGG - Intronic
955608663 3:60733722-60733744 GTGTAATTAGAGAAAGATAAAGG - Intronic
955988730 3:64602219-64602241 TTGAATGTTCAGAAAGAGAAAGG + Intronic
956168827 3:66416896-66416918 CTGACATTACAGACAGACAAGGG - Intronic
956383469 3:68690574-68690596 CTGATTTTACAGAAATAAAAAGG - Intergenic
956568987 3:70672953-70672975 GTGAGGATACAGCAAGACAATGG + Intergenic
957131561 3:76229620-76229642 GTGAATATAGAGAAAGGGAATGG - Intronic
957840717 3:85665659-85665681 GTGGACTACCAGAAAGACAAAGG - Intronic
957874324 3:86125787-86125809 GTGGATTCACAGATACACAAAGG + Intergenic
958015337 3:87933803-87933825 GTTAGTTTAAAGAAAGACTATGG - Intergenic
958483806 3:94677509-94677531 GTGAATTGACAGAAATAAATAGG + Intergenic
958580659 3:96017081-96017103 ATGAAATTACAAAAAGTCAAGGG + Intergenic
958743668 3:98107648-98107670 TTAATTTTAAAGAAAGACAAAGG - Intergenic
958781220 3:98544953-98544975 ATGAAGTTCCCGAAAGACAAGGG - Intronic
959206441 3:103312989-103313011 CAGAATCTACAGAAATACAATGG - Intergenic
959423631 3:106158100-106158122 GTCAATTTACAGAAAATCAGTGG + Intergenic
959603091 3:108210928-108210950 GTGAATTTAGAGAAATATACTGG - Intronic
959898711 3:111635464-111635486 ATGAAATTACAAAAAGAAAATGG + Intronic
959970904 3:112408730-112408752 GTGATTTAAAAGATAGACAAAGG + Intergenic
961780578 3:129317986-129318008 GTGAATTTCCTGACAGAGAACGG + Intergenic
962187431 3:133274602-133274624 GTGAATTTATCTAAAGACAGTGG + Intronic
962531588 3:136286102-136286124 GTAAATGGACAGAAAGACCAAGG + Intronic
962645973 3:137440735-137440757 GGGGATTTACAGGAAGAGAATGG + Intergenic
963282534 3:143399187-143399209 GAAAGTTGACAGAAAGACAATGG + Intronic
963608420 3:147434635-147434657 GTGAATTTATGGAGAGATAAAGG - Intronic
964031204 3:152140973-152140995 GTAAATGTAAAGAAAGACCAGGG + Intergenic
965047195 3:163594313-163594335 GTGAATTTTCAGTAATACACAGG - Intergenic
968200367 3:196748689-196748711 GTGAATGTACATCCAGACAATGG - Intronic
969708490 4:8829301-8829323 ATGAAGAGACAGAAAGACAAAGG + Intergenic
970314248 4:14814374-14814396 CTGAATTTACAGATAATCAATGG + Intergenic
970343381 4:15130055-15130077 GTGTATTTACTGAGAGAGAAAGG - Intergenic
971277263 4:25210144-25210166 TTGAGTTTACAGAAAGAATAGGG + Intronic
971755963 4:30709076-30709098 ATGAAATCACAGAAATACAAAGG - Intergenic
971850718 4:31983375-31983397 TTGAAGTTACAGAAAGAATAGGG + Intergenic
972702714 4:41509486-41509508 GTGATTTGGCAGAAGGACAAGGG - Intronic
973306699 4:48660093-48660115 GAGAAGGTAGAGAAAGACAAGGG + Intronic
974154800 4:58057166-58057188 CTGAGTTTGCAGAAAGATAAAGG - Intergenic
974664754 4:64945463-64945485 CTGAATTTACAGAAAAGAAAAGG + Intergenic
974680304 4:65152164-65152186 TTTAATTTATAGAGAGACAAGGG + Intergenic
974784892 4:66607516-66607538 GTGAATTTTCAGATAGAGAAAGG + Intergenic
974821360 4:67070594-67070616 GTGAATACACAGAAAGACAGAGG + Intergenic
976305866 4:83558881-83558903 CTGAATTTAGAGAAAAACCAAGG + Intronic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
977142972 4:93398877-93398899 GAGTAGTTACAGAAAGACATAGG - Intronic
977522029 4:98096803-98096825 ATGAATTTGCAGAAATTCAAAGG + Intronic
978082120 4:104606206-104606228 GTAAATTGGCAGCAAGACAAAGG + Intergenic
978265199 4:106815602-106815624 GTGGATGGACAGAAAGATAAAGG + Intergenic
979513946 4:121585515-121585537 CTGTATTTACATAAAGAAAATGG + Intergenic
979749786 4:124264635-124264657 GGGAATTTACAGATAAGCAAGGG - Intergenic
979755433 4:124334147-124334169 ATGAATTTAAATAAAAACAATGG + Intergenic
980021351 4:127713924-127713946 ATTAATTTACAGAAAAAGAAAGG + Exonic
980071230 4:128244374-128244396 GTGTATTTAAAGAAAGGCAAGGG - Intergenic
980654250 4:135761466-135761488 GTGAATTTACAAAGATAAAAAGG - Intergenic
980709524 4:136546274-136546296 CTGTATTTAGGGAAAGACAAAGG + Intergenic
980784821 4:137538500-137538522 TTAAATTCACAGAAAGAGAAGGG + Intergenic
981054485 4:140346282-140346304 GTGATTGTCCAGAAAGACATCGG + Intronic
981323641 4:143422113-143422135 GTGTATTTAGAGTAAGAAAATGG + Intronic
981724576 4:147834123-147834145 GTGACTTTATAGAAAGAAAAAGG - Intronic
981839839 4:149098648-149098670 GGAAATTTACAGATAGGCAAGGG - Intergenic
981983600 4:150827372-150827394 GTAAATTTACAGAAATGCACTGG - Intronic
982285821 4:153733385-153733407 GCGAGTTTACAGAAAAGCAAGGG - Intronic
982428607 4:155296453-155296475 GTGAATTAACAGACATACTAAGG - Intergenic
982986736 4:162218469-162218491 GGGAGATTACAGAAAAACAAGGG + Intergenic
984334439 4:178371039-178371061 CTGAAATCACAGAAATACAAAGG - Intergenic
984340441 4:178450129-178450151 GTGAATTTTCAGAGAGTGAAGGG - Intergenic
984359716 4:178712514-178712536 GAGAATTTCCAGACAGACATAGG + Intergenic
984405598 4:179325566-179325588 GGGAAGTCACTGAAAGACAATGG - Intergenic
984518599 4:180772946-180772968 TTGAGGTTACAGAAAGACTAGGG + Intergenic
985365056 4:189221465-189221487 TTGATCTTACAGAAAGTCAATGG + Intergenic
985649062 5:1098948-1098970 ATGAATGTGCAGAATGACAAGGG - Intronic
986059823 5:4177568-4177590 GTGAAGATACAGCAAGAAAATGG - Intergenic
988037265 5:25843500-25843522 ATGATTTCACAGAAAGACAAAGG + Intergenic
988347645 5:30059253-30059275 GTAAATTTACAGATAAATAAGGG - Intergenic
988358726 5:30208426-30208448 GGGACATTACTGAAAGACAATGG - Intergenic
988821233 5:34888140-34888162 GTGAGTTTACAGAAAGAAGATGG + Intronic
989361060 5:40601701-40601723 GAGGAACTACAGAAAGACAAAGG + Intergenic
990235288 5:53760648-53760670 GGGAAGTTACAGACAGAAAAGGG + Intergenic
990484799 5:56247590-56247612 GGGAAATTACAGAAACAAAATGG + Intergenic
990598669 5:57335770-57335792 GTGAATTTACAGAGAAACAAAGG + Intergenic
990929373 5:61071217-61071239 ATAAATTTACAGTAGGACAAGGG - Intronic
991239376 5:64440194-64440216 GTGAATTTACAGAAATAGAGAGG + Intergenic
992315403 5:75547762-75547784 GTGAATTGATAGAAACACCATGG - Intronic
993042679 5:82833360-82833382 TTGAAGTTACAGAAAGAACAGGG + Intergenic
993148898 5:84134934-84134956 GTTAATTCACAGAAAAGCAAAGG + Intronic
993333417 5:86627556-86627578 ATGAACTTACAGCAAGACTATGG + Intergenic
993763507 5:91826770-91826792 ATGAATGTAGAGCAAGACAAAGG + Intergenic
994059031 5:95453502-95453524 GTGAATTTACTGTGAAACAATGG - Intergenic
994076147 5:95651959-95651981 GTGAACTTACAAAGAGAAAAGGG + Intronic
994152698 5:96467127-96467149 GACAATTTACAGAAAAAAAATGG - Intergenic
994526108 5:100906459-100906481 ATGAATTTACATTAAGTCAAAGG - Intergenic
995182778 5:109244524-109244546 ATGAATTAACACAAACACAATGG - Intergenic
995950825 5:117711185-117711207 GTGAAGTTACAGTAATAAAATGG - Intergenic
996836550 5:127800010-127800032 ATTAATTTTCAGAAAGAAAATGG + Intergenic
997443288 5:133923897-133923919 GAGAATTTACAGACAGAAAAAGG - Intergenic
998340438 5:141413091-141413113 CTGAAGCCACAGAAAGACAAAGG + Intronic
998499683 5:142621523-142621545 GTGAATTTTAAGAAAGAGTAGGG - Intronic
998674512 5:144391996-144392018 GTGAATTTACAGAGGAAGAAAGG + Intronic
998735857 5:145139686-145139708 CTGAAATCACAGAAACACAAAGG - Intergenic
999469611 5:151841652-151841674 TTGACTTTACAGAAATAAAAAGG + Intronic
999496445 5:152103414-152103436 GTGAAATTAAAGGAAGACAGAGG - Intergenic
1000166430 5:158653578-158653600 CTGAATTGACAGAAACACATGGG - Intergenic
1000702968 5:164475969-164475991 GTGAATTTATAGTAAGAGATAGG - Intergenic
1001221796 5:169906715-169906737 GTGATTTGGCAGAAAGATAATGG - Intronic
1001282031 5:170393028-170393050 GTGCTTTTACAGAAAGAACAAGG - Intronic
1001298778 5:170518523-170518545 ATGAACTTGCAGAAAGACACAGG + Intronic
1001932860 5:175685571-175685593 ATGAAGTTACAGAAAATCAATGG + Exonic
1002833246 6:843425-843447 GGGAATTTACAGTAAGTAAATGG + Intergenic
1005255529 6:23998860-23998882 GTGAATTTATATAAATCCAATGG + Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005971212 6:30763374-30763396 GTGCTTATACAGAAAGGCAAAGG + Intergenic
1006957901 6:37892778-37892800 TTGACCTTACAGAAATACAAAGG + Intronic
1007257388 6:40538433-40538455 ATGAATTATCAGAAACACAATGG + Intronic
1007974855 6:46091012-46091034 GAGGATTTACAGACAGAAAAAGG - Intergenic
1008281110 6:49597349-49597371 GTGAATAAACAAAAAGAAAAAGG + Intergenic
1008345961 6:50427329-50427351 GGGAATTCACAGAAATACATGGG + Intergenic
1008922947 6:56861916-56861938 GTGAGTTGAAAAAAAGACAAGGG + Intronic
1009354918 6:62731352-62731374 GTGAAGTTACAGAAAGAAGGTGG - Intergenic
1009358614 6:62786155-62786177 GTGAGGTTACAGCAAGAAAATGG - Intergenic
1010949991 6:82024231-82024253 TTGAATTTACAGAGACAGAAAGG - Intergenic
1011754876 6:90488199-90488221 GAGTATTTACAGAGAGAAAAAGG - Intergenic
1012060055 6:94467009-94467031 GTGCATTTAAAGAAAGAAACTGG - Intergenic
1012072166 6:94636736-94636758 GTGAATTTCCATCAAGCCAAGGG - Intergenic
1012169213 6:95998090-95998112 GGGAGTTTACAGATAAACAAGGG - Intergenic
1012383949 6:98655277-98655299 ATAAATTTAAAAAAAGACAATGG + Intergenic
1012469480 6:99554994-99555016 GGGAATTTACAGATAAGCAAAGG - Intronic
1012661031 6:101892059-101892081 GTTAATTTAAAAAAAAACAAGGG - Intronic
1012761056 6:103301681-103301703 GATAATTTAGAGCAAGACAAAGG - Intergenic
1012850388 6:104439736-104439758 GTGAAGGTCCACAAAGACAATGG + Intergenic
1013083234 6:106831370-106831392 TTGATTTTACAGACAGAAAAGGG - Intergenic
1014096192 6:117464787-117464809 GTGAACATACAGAAGAACAAGGG + Intronic
1015058941 6:128939052-128939074 GTGAATTTCCAAAAAATCAAAGG + Intronic
1015833913 6:137398856-137398878 CGGAATTTACAGACAGCCAAGGG - Intergenic
1015899416 6:138049329-138049351 GTGTATATATAGAGAGACAAAGG - Intergenic
1015961863 6:138658583-138658605 GTGCATCCACTGAAAGACAAAGG + Intronic
1016726744 6:147379307-147379329 GTGAATTAAAAGAAATACTATGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017209394 6:151838186-151838208 GTGATGGTACAGAAAAACAAAGG + Intronic
1017565821 6:155685491-155685513 GGGTATATAAAGAAAGACAATGG + Intergenic
1018053034 6:160028217-160028239 GTGAAGACACAGAAAGAAAACGG - Intronic
1018726640 6:166617921-166617943 GTGAATTTACAGAAAACCTCGGG - Intronic
1019876123 7:3812503-3812525 GTGAATTCACATAAATTCAATGG + Intronic
1020477304 7:8612152-8612174 GAGAAATGACAGAAAGAGAAAGG - Intronic
1021314088 7:19124779-19124801 ATAAATTAAAAGAAAGACAAAGG + Intergenic
1021377300 7:19923819-19923841 GTCAAGTTAAAGAAAGCCAAAGG + Intergenic
1021569238 7:22047841-22047863 GTGAATTTAAAAAAAATCAAAGG + Intergenic
1022573511 7:31475712-31475734 GTTCATTTACAGATAGACAGTGG - Intergenic
1022651431 7:32280184-32280206 GTAAATTTGTAGAAAGACAGTGG + Intronic
1022871274 7:34482594-34482616 GTGAATTTACATCAAAACTAAGG + Intergenic
1022883453 7:34616248-34616270 TTGATTTTACAGAAATAAAAAGG + Intergenic
1023340724 7:39216531-39216553 GTGAATTTAAAGGAGTACAAGGG + Intronic
1023896446 7:44437380-44437402 GAGAATTTACAAAGAAACAAAGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024778606 7:52819561-52819583 CTGATATTACAGAAAAACAAAGG + Intergenic
1024924071 7:54594204-54594226 GTAAATTTAATGGAAGACAAAGG + Intergenic
1026213676 7:68329233-68329255 GTGAATGTCCAGAGAGAAAAAGG - Intergenic
1026453492 7:70550625-70550647 GGGAATTTACAGATAAACTAGGG + Intronic
1027529970 7:79318003-79318025 GTGAATTCACAGAAATCCAGAGG - Intronic
1027837049 7:83257545-83257567 GTGAATTCAAAGAAAGTAAAGGG + Intergenic
1028566353 7:92236070-92236092 CTGTTCTTACAGAAAGACAAAGG + Intronic
1029913815 7:104184977-104184999 CTGAGGTTACAGAAAGAAAATGG - Intronic
1030340868 7:108378711-108378733 GTGAAATTTCAGAAATCCAAAGG + Intronic
1030634675 7:111935430-111935452 GTGAATAGACAGAAAAACAAAGG + Intronic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031346386 7:120671955-120671977 ATAAATTTACAAAAAGAAAAAGG - Intronic
1031964321 7:128016673-128016695 GTGACTTTAGAGAAAGAAAAAGG - Intronic
1032316796 7:130845415-130845437 GGGAATTTAGAGAAAAACGAAGG - Intergenic
1032621827 7:133542089-133542111 GTGAATCTTCAGAAGGCCAAGGG - Intronic
1032819818 7:135513935-135513957 GTGAATTTAGAGAAAGGCAAGGG + Intergenic
1033289284 7:140069358-140069380 CTGACTTTACAGAAATAGAAAGG + Intergenic
1033906833 7:146215956-146215978 GTGAATTGAAAGAAATACATGGG + Intronic
1033939688 7:146637237-146637259 GTGAAGTTGCAGAAACACAAAGG + Intronic
1034308781 7:150069270-150069292 GTGAACTTAAAGAAACAAAAAGG - Intergenic
1034359509 7:150481668-150481690 GTGTATTCACAGAAATACAGAGG - Intergenic
1034403078 7:150878910-150878932 GTGAAACTACTAAAAGACAAAGG + Intergenic
1034798072 7:154031372-154031394 GTGAACTTAAAGAAACAAAAAGG + Intronic
1035545256 8:476664-476686 CTGATTTTACAGAAATAAAAAGG - Intergenic
1036114045 8:5939032-5939054 GTGAGTAAACAGAAAAACAAAGG + Intergenic
1036271211 8:7304694-7304716 CTGAATTTAAAGAAAGAAAAAGG - Intergenic
1036350138 8:8005649-8005671 CTGAATTTAAAGAAAGAAAAAGG + Intergenic
1036483485 8:9158834-9158856 AAGAATTAACAGAAAGAAAATGG - Intronic
1037034787 8:14153040-14153062 GTGAGGTTTCAAAAAGACAAGGG + Intronic
1037052742 8:14396864-14396886 GTGCATTTAAAAAAAGACAGAGG + Intronic
1038094658 8:24294431-24294453 GAGAATATACAGAAATAAAAGGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039191584 8:34982447-34982469 GTGATTTTATAGACAAACAATGG + Intergenic
1039486485 8:37914038-37914060 TTGAAGTTACAGAAAGAATAGGG - Intergenic
1040994574 8:53388929-53388951 GAGAATCTCCAGAAAAACAAGGG - Intergenic
1040995212 8:53394169-53394191 GAGAATCTCCAGAAAAACAAGGG + Intergenic
1041126970 8:54651579-54651601 TTGACTTTACAGAAATAAAAAGG - Intergenic
1043002251 8:74773267-74773289 TTTAATTTTCAGAAAGAAAATGG - Intronic
1043868850 8:85406815-85406837 GTGAATATACTAAAAGACACTGG + Intronic
1044989598 8:97783786-97783808 CTGAAGTTACAGAAAGAATAGGG - Intronic
1045748909 8:105458296-105458318 GTGTATTTACCCAAAGATAAAGG - Intronic
1046133782 8:109999774-109999796 GTGATTTTACAGAAAAAACAAGG - Intergenic
1046645709 8:116783263-116783285 GTAAATTTGCAAAAAAACAAAGG - Intronic
1047037979 8:120960569-120960591 GGGAATTTGCAGAGAGAGAAAGG - Intergenic
1047261408 8:123264130-123264152 GTGAATTAAGAGTAAAACAAGGG + Intronic
1047901948 8:129432199-129432221 GTGAAATTGGAGAAAGACCACGG - Intergenic
1048652336 8:136491975-136491997 GGGAATTTGTAGAAAAACAATGG - Intergenic
1049121806 8:140746353-140746375 GTGAATTCCCAAAAAGATAAAGG + Intronic
1049127895 8:140809049-140809071 ATGAGTATACAGAAATACAATGG + Intronic
1050243493 9:3661978-3662000 GGGAATTAAAAGGAAGACAAGGG - Intergenic
1050959300 9:11706812-11706834 GTGAATTTCCAGGGAGCCAAGGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051311897 9:15783992-15784014 ATGAATTTAGATAATGACAATGG + Intronic
1051612346 9:18973416-18973438 GTGAAATTTCAGAAACACATAGG + Intronic
1051753289 9:20367094-20367116 GAGAATTTACAAAAAAACAATGG - Intronic
1051859934 9:21613002-21613024 GTCACTTTACAGAAAGAAAATGG + Intergenic
1051952658 9:22655560-22655582 GTTAATTTAGAAAAAGAAAACGG + Intergenic
1052554102 9:29991008-29991030 TTGAATTTAGAGAGAGACAGTGG - Intergenic
1052921339 9:33972510-33972532 CTGAAGTTAGAGAGAGACAAAGG + Intronic
1053621542 9:39824545-39824567 GTGAAGCCACAAAAAGACAAGGG + Intergenic
1053636613 9:40012765-40012787 ATAAATATGCAGAAAGACAAAGG + Intergenic
1053883554 9:42619760-42619782 GTGAAGCCACAAAAAGACAAGGG - Intergenic
1053889115 9:42674538-42674560 GTGAAGCCACAAAAAGACAAGGG + Intergenic
1054222574 9:62427224-62427246 GTGAAGCCACAAAAAGACAAGGG - Intergenic
1054228136 9:62481951-62481973 GTGAAGCCACAAAAAGACAAGGG + Intergenic
1054837605 9:69694963-69694985 CTGATACTACAGAAAGACAAAGG - Intergenic
1054843550 9:69768963-69768985 ATGCAGTTACAGAAAGATAATGG + Intergenic
1055247382 9:74263575-74263597 GTAAATTAACAGGAAGAAAAAGG - Intergenic
1055782404 9:79833523-79833545 GTGAAAGAAAAGAAAGACAAGGG - Intergenic
1055990556 9:82101735-82101757 GTGAATGCACTGAAATACAAAGG - Intergenic
1056726900 9:89127201-89127223 GAGAATTTAAAAAATGACAAAGG - Intronic
1057137702 9:92705368-92705390 ATGACCTTACAGAAAGAAAAAGG - Intergenic
1057137996 9:92707887-92707909 ATGACCTTACAGAAAGAAAAAGG - Intergenic
1057539375 9:95951623-95951645 CTGATTTTACAGAAATAAAAAGG + Intronic
1057931962 9:99201451-99201473 GTTTATTTACAGGAAAACAAAGG - Intergenic
1058125792 9:101193271-101193293 GGGGAATTACAGAAAGACAGGGG - Intronic
1058737829 9:107910640-107910662 GAGAATTTAAGGAAAGAAAATGG - Intergenic
1059210443 9:112509902-112509924 GTGAATTAACATGAAGACACTGG + Intronic
1059678316 9:116561874-116561896 GTGAATTGAGAGGAAGTCAAGGG - Intronic
1060296964 9:122349492-122349514 GTGAACTTACATGAAGAAAACGG + Intergenic
1060380606 9:123166908-123166930 GTTAGAATACAGAAAGACAACGG + Intronic
1060861641 9:126959859-126959881 GAGAATTGACAGAAAGTCAGTGG + Intronic
1061320637 9:129826417-129826439 GGGAATTCACAGATAAACAAGGG - Intergenic
1185764089 X:2710448-2710470 GTGAAATTACAGAAATAAGAAGG + Intronic
1187092163 X:16107916-16107938 GTGAAATTACAGTGAGAAAATGG + Intergenic
1188190658 X:27168142-27168164 GTGAGTCCACAGAAAGAGAATGG + Intergenic
1188750849 X:33904361-33904383 GTGACTTTATAGACAGAGAAGGG - Intergenic
1188836375 X:34960886-34960908 GGGAATTAACATAAAGAAAAGGG + Intergenic
1189399446 X:40652929-40652951 GAGAAGGTACAGAAAGAAAAAGG + Intronic
1189560921 X:42190832-42190854 GTGAATTAACAGAATGAATAGGG - Intergenic
1190231901 X:48588654-48588676 GTGAAACGACAGAAAAACAAAGG - Intergenic
1190798322 X:53764612-53764634 GTGAAGATAAAGAAAGAGAATGG - Intergenic
1192054670 X:67760868-67760890 GTGAGTTTAACGAAAGAGAATGG + Intergenic
1192755272 X:74040552-74040574 GTTAATTAACATACAGACAAAGG - Intergenic
1193327334 X:80194650-80194672 GAGAATTATCAAAAAGACAAAGG - Intergenic
1193443545 X:81571594-81571616 CTGATGTCACAGAAAGACAAAGG + Intergenic
1194175705 X:90645510-90645532 GTTAATTAACAGAAACACAGTGG - Intergenic
1195594260 X:106670257-106670279 GTGAAATTACTGAAAGTCTAAGG - Intronic
1196035867 X:111144288-111144310 TTGAATATATAGAAAGACATAGG + Intronic
1196732693 X:118957089-118957111 CTGACTTTACAGAAATAAAATGG + Intergenic
1196822769 X:119715588-119715610 CTGACTTTACAGAAATAAAAAGG + Intergenic
1197654577 X:129102698-129102720 GTTGATTTACAGAAAGAGCAAGG - Intergenic
1199279842 X:145988432-145988454 GTGAAGTTACAGCAAGAAGATGG + Intergenic
1199673568 X:150166179-150166201 GTGTATTTATACAAAGAGAAAGG + Intergenic
1200090320 X:153632926-153632948 GTGCATTTAGAGAAAGGGAATGG + Intergenic
1200522346 Y:4226468-4226490 GTTAATTAACAGAAACACAGTGG - Intergenic