ID: 1106869165

View in Genome Browser
Species Human (GRCh38)
Location 13:34000378-34000400
Sequence AAAGGAAATCATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106869165_1106869176 27 Left 1106869165 13:34000378-34000400 CCTTCCTCCTCATGATTTCCTTT No data
Right 1106869176 13:34000428-34000450 CTGCATGACTGACTCCACCTTGG 0: 1
1: 0
2: 1
3: 19
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106869165 Original CRISPR AAAGGAAATCATGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr