ID: 1106869524

View in Genome Browser
Species Human (GRCh38)
Location 13:34003558-34003580
Sequence CAAGAGAGAGGCCGACCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106869524_1106869533 30 Left 1106869524 13:34003558-34003580 CCAAAGGGTCGGCCTCTCTCTTG No data
Right 1106869533 13:34003611-34003633 GCTCCACTCCACCGAGGCGAGGG No data
1106869524_1106869532 29 Left 1106869524 13:34003558-34003580 CCAAAGGGTCGGCCTCTCTCTTG No data
Right 1106869532 13:34003610-34003632 CGCTCCACTCCACCGAGGCGAGG No data
1106869524_1106869531 24 Left 1106869524 13:34003558-34003580 CCAAAGGGTCGGCCTCTCTCTTG No data
Right 1106869531 13:34003605-34003627 AGGCGCGCTCCACTCCACCGAGG No data
1106869524_1106869527 4 Left 1106869524 13:34003558-34003580 CCAAAGGGTCGGCCTCTCTCTTG No data
Right 1106869527 13:34003585-34003607 CTAACTTTGTATTCCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106869524 Original CRISPR CAAGAGAGAGGCCGACCCTT TGG (reversed) Intergenic
No off target data available for this crispr