ID: 1106869528

View in Genome Browser
Species Human (GRCh38)
Location 13:34003598-34003620
Sequence GGAGTGGAGCGCGCCTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106869528_1106869533 -10 Left 1106869528 13:34003598-34003620 CCCATCCAGGCGCGCTCCACTCC No data
Right 1106869533 13:34003611-34003633 GCTCCACTCCACCGAGGCGAGGG No data
1106869528_1106869534 -9 Left 1106869528 13:34003598-34003620 CCCATCCAGGCGCGCTCCACTCC No data
Right 1106869534 13:34003612-34003634 CTCCACTCCACCGAGGCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106869528 Original CRISPR GGAGTGGAGCGCGCCTGGAT GGG (reversed) Intergenic