ID: 1106869528 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:34003598-34003620 |
Sequence | GGAGTGGAGCGCGCCTGGAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1106869528_1106869533 | -10 | Left | 1106869528 | 13:34003598-34003620 | CCCATCCAGGCGCGCTCCACTCC | No data | ||
Right | 1106869533 | 13:34003611-34003633 | GCTCCACTCCACCGAGGCGAGGG | No data | ||||
1106869528_1106869534 | -9 | Left | 1106869528 | 13:34003598-34003620 | CCCATCCAGGCGCGCTCCACTCC | No data | ||
Right | 1106869534 | 13:34003612-34003634 | CTCCACTCCACCGAGGCGAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1106869528 | Original CRISPR | GGAGTGGAGCGCGCCTGGAT GGG (reversed) | Intergenic | ||