ID: 1106869529

View in Genome Browser
Species Human (GRCh38)
Location 13:34003599-34003621
Sequence TGGAGTGGAGCGCGCCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106869529_1106869534 -10 Left 1106869529 13:34003599-34003621 CCATCCAGGCGCGCTCCACTCCA No data
Right 1106869534 13:34003612-34003634 CTCCACTCCACCGAGGCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106869529 Original CRISPR TGGAGTGGAGCGCGCCTGGA TGG (reversed) Intergenic
No off target data available for this crispr