ID: 1106869533 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:34003611-34003633 |
| Sequence | GCTCCACTCCACCGAGGCGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1106869524_1106869533 | 30 | Left | 1106869524 | 13:34003558-34003580 | CCAAAGGGTCGGCCTCTCTCTTG | No data | ||
| Right | 1106869533 | 13:34003611-34003633 | GCTCCACTCCACCGAGGCGAGGG | No data | ||||
| 1106869528_1106869533 | -10 | Left | 1106869528 | 13:34003598-34003620 | CCCATCCAGGCGCGCTCCACTCC | No data | ||
| Right | 1106869533 | 13:34003611-34003633 | GCTCCACTCCACCGAGGCGAGGG | No data | ||||
| 1106869526_1106869533 | 18 | Left | 1106869526 | 13:34003570-34003592 | CCTCTCTCTTGGTTTCTAACTTT | No data | ||
| Right | 1106869533 | 13:34003611-34003633 | GCTCCACTCCACCGAGGCGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1106869533 | Original CRISPR | GCTCCACTCCACCGAGGCGA GGG | Intergenic | ||