ID: 1106870498

View in Genome Browser
Species Human (GRCh38)
Location 13:34013731-34013753
Sequence TATTTAGGAGGTACGATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106870492_1106870498 28 Left 1106870492 13:34013680-34013702 CCCAAATTACACGGGGCAGTGAG No data
Right 1106870498 13:34013731-34013753 TATTTAGGAGGTACGATGCCAGG No data
1106870493_1106870498 27 Left 1106870493 13:34013681-34013703 CCAAATTACACGGGGCAGTGAGG No data
Right 1106870498 13:34013731-34013753 TATTTAGGAGGTACGATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106870498 Original CRISPR TATTTAGGAGGTACGATGCC AGG Intergenic
No off target data available for this crispr