ID: 1106872212

View in Genome Browser
Species Human (GRCh38)
Location 13:34033999-34034021
Sequence TTCTAGTTGGATATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106872212_1106872218 30 Left 1106872212 13:34033999-34034021 CCTTCCACCATATCCAACTAGAA No data
Right 1106872218 13:34034052-34034074 TCAAACATTGAACAAGAGGTAGG No data
1106872212_1106872217 26 Left 1106872212 13:34033999-34034021 CCTTCCACCATATCCAACTAGAA No data
Right 1106872217 13:34034048-34034070 ACTTTCAAACATTGAACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106872212 Original CRISPR TTCTAGTTGGATATGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr