ID: 1106876079

View in Genome Browser
Species Human (GRCh38)
Location 13:34075123-34075145
Sequence ATCTGATACTAGAGGTACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106876071_1106876079 27 Left 1106876071 13:34075073-34075095 CCCGTGCCTTTTCCTGGGCATGT No data
Right 1106876079 13:34075123-34075145 ATCTGATACTAGAGGTACACTGG No data
1106876074_1106876079 21 Left 1106876074 13:34075079-34075101 CCTTTTCCTGGGCATGTGTGGTG No data
Right 1106876079 13:34075123-34075145 ATCTGATACTAGAGGTACACTGG No data
1106876072_1106876079 26 Left 1106876072 13:34075074-34075096 CCGTGCCTTTTCCTGGGCATGTG No data
Right 1106876079 13:34075123-34075145 ATCTGATACTAGAGGTACACTGG No data
1106876070_1106876079 28 Left 1106876070 13:34075072-34075094 CCCCGTGCCTTTTCCTGGGCATG No data
Right 1106876079 13:34075123-34075145 ATCTGATACTAGAGGTACACTGG No data
1106876075_1106876079 15 Left 1106876075 13:34075085-34075107 CCTGGGCATGTGTGGTGATCTTC No data
Right 1106876079 13:34075123-34075145 ATCTGATACTAGAGGTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106876079 Original CRISPR ATCTGATACTAGAGGTACAC TGG Intergenic
No off target data available for this crispr