ID: 1106880543

View in Genome Browser
Species Human (GRCh38)
Location 13:34124730-34124752
Sequence TTTTTTAATGAATCCAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106880543_1106880544 20 Left 1106880543 13:34124730-34124752 CCTGAGTTGGATTCATTAAAAAA No data
Right 1106880544 13:34124773-34124795 CAAGCTGTATACATTAATCTTGG No data
1106880543_1106880545 21 Left 1106880543 13:34124730-34124752 CCTGAGTTGGATTCATTAAAAAA No data
Right 1106880545 13:34124774-34124796 AAGCTGTATACATTAATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106880543 Original CRISPR TTTTTTAATGAATCCAACTC AGG (reversed) Intergenic
No off target data available for this crispr