ID: 1106880544

View in Genome Browser
Species Human (GRCh38)
Location 13:34124773-34124795
Sequence CAAGCTGTATACATTAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106880543_1106880544 20 Left 1106880543 13:34124730-34124752 CCTGAGTTGGATTCATTAAAAAA No data
Right 1106880544 13:34124773-34124795 CAAGCTGTATACATTAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106880544 Original CRISPR CAAGCTGTATACATTAATCT TGG Intergenic
No off target data available for this crispr