ID: 1106881001

View in Genome Browser
Species Human (GRCh38)
Location 13:34130236-34130258
Sequence GTCCTTCGGGGCCACCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106881001_1106881008 25 Left 1106881001 13:34130236-34130258 CCATCCAGGTGGCCCCGAAGGAC No data
Right 1106881008 13:34130284-34130306 AGAGCTTTGAGAAGTGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106881001 Original CRISPR GTCCTTCGGGGCCACCTGGA TGG (reversed) Intergenic
No off target data available for this crispr