ID: 1106881627

View in Genome Browser
Species Human (GRCh38)
Location 13:34138279-34138301
Sequence CTGAATATACAAACTGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106881626_1106881627 11 Left 1106881626 13:34138245-34138267 CCAGGTGGCAGGGGATACTTTGT No data
Right 1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG No data
1106881620_1106881627 23 Left 1106881620 13:34138233-34138255 CCAAGATGCCACCCAGGTGGCAG No data
Right 1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG No data
1106881625_1106881627 12 Left 1106881625 13:34138244-34138266 CCCAGGTGGCAGGGGATACTTTG No data
Right 1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG No data
1106881624_1106881627 15 Left 1106881624 13:34138241-34138263 CCACCCAGGTGGCAGGGGATACT No data
Right 1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106881627 Original CRISPR CTGAATATACAAACTGACAT TGG Intergenic
No off target data available for this crispr