ID: 1106881702

View in Genome Browser
Species Human (GRCh38)
Location 13:34138908-34138930
Sequence CCTCATCAGCAGAGGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106881702_1106881710 26 Left 1106881702 13:34138908-34138930 CCTCTCTGCCTCTGCTGATGAGG No data
Right 1106881710 13:34138957-34138979 CTATATCCACTTAATATGGTGGG No data
1106881702_1106881709 25 Left 1106881702 13:34138908-34138930 CCTCTCTGCCTCTGCTGATGAGG No data
Right 1106881709 13:34138956-34138978 TCTATATCCACTTAATATGGTGG No data
1106881702_1106881708 22 Left 1106881702 13:34138908-34138930 CCTCTCTGCCTCTGCTGATGAGG No data
Right 1106881708 13:34138953-34138975 CAGTCTATATCCACTTAATATGG No data
1106881702_1106881711 27 Left 1106881702 13:34138908-34138930 CCTCTCTGCCTCTGCTGATGAGG No data
Right 1106881711 13:34138958-34138980 TATATCCACTTAATATGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106881702 Original CRISPR CCTCATCAGCAGAGGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr