ID: 1106884270

View in Genome Browser
Species Human (GRCh38)
Location 13:34166658-34166680
Sequence CTGTGGGTATGTGGAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106884265_1106884270 1 Left 1106884265 13:34166634-34166656 CCTTGAGGGGAAGGTTGACCAAA No data
Right 1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106884270 Original CRISPR CTGTGGGTATGTGGAAAAGA AGG Intergenic
No off target data available for this crispr