ID: 1106887095

View in Genome Browser
Species Human (GRCh38)
Location 13:34198853-34198875
Sequence CTAGTCCACCCTTTCTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106887095_1106887098 5 Left 1106887095 13:34198853-34198875 CCTCTAGAGAAAGGGTGGACTAG No data
Right 1106887098 13:34198881-34198903 AAATTTAATCTTTTGGTGTAGGG No data
1106887095_1106887099 6 Left 1106887095 13:34198853-34198875 CCTCTAGAGAAAGGGTGGACTAG No data
Right 1106887099 13:34198882-34198904 AATTTAATCTTTTGGTGTAGGGG No data
1106887095_1106887096 -2 Left 1106887095 13:34198853-34198875 CCTCTAGAGAAAGGGTGGACTAG No data
Right 1106887096 13:34198874-34198896 AGAAAAAAAATTTAATCTTTTGG No data
1106887095_1106887097 4 Left 1106887095 13:34198853-34198875 CCTCTAGAGAAAGGGTGGACTAG No data
Right 1106887097 13:34198880-34198902 AAAATTTAATCTTTTGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106887095 Original CRISPR CTAGTCCACCCTTTCTCTAG AGG (reversed) Intergenic
No off target data available for this crispr