ID: 1106894657

View in Genome Browser
Species Human (GRCh38)
Location 13:34286473-34286495
Sequence GATTCTGGACAGAGAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106894657_1106894660 -5 Left 1106894657 13:34286473-34286495 CCCACAGCTCTCTGTCCAGAATC No data
Right 1106894660 13:34286491-34286513 GAATCCAAAATGCCTTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106894657 Original CRISPR GATTCTGGACAGAGAGCTGT GGG (reversed) Intergenic
No off target data available for this crispr