ID: 1106895736

View in Genome Browser
Species Human (GRCh38)
Location 13:34300386-34300408
Sequence TGACTTAGATTTTGTTAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106895736_1106895742 24 Left 1106895736 13:34300386-34300408 CCATATTAACAAAATCTAAGTCA No data
Right 1106895742 13:34300433-34300455 GGCAGAAAGAGAAAGGAACCAGG No data
1106895736_1106895741 17 Left 1106895736 13:34300386-34300408 CCATATTAACAAAATCTAAGTCA No data
Right 1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG No data
1106895736_1106895737 3 Left 1106895736 13:34300386-34300408 CCATATTAACAAAATCTAAGTCA No data
Right 1106895737 13:34300412-34300434 CTCACCTCCTGAGTCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106895736 Original CRISPR TGACTTAGATTTTGTTAATA TGG (reversed) Intergenic
No off target data available for this crispr