ID: 1106895739

View in Genome Browser
Species Human (GRCh38)
Location 13:34300419-34300441
Sequence CTTTCTGCCTTTGAGGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106895739_1106895746 17 Left 1106895739 13:34300419-34300441 CCTGAGTCCTCAAAGGCAGAAAG No data
Right 1106895746 13:34300459-34300481 TAACTTCTGCAGTGGAAATGAGG No data
1106895739_1106895744 9 Left 1106895739 13:34300419-34300441 CCTGAGTCCTCAAAGGCAGAAAG No data
Right 1106895744 13:34300451-34300473 CCAGGACCTAACTTCTGCAGTGG No data
1106895739_1106895742 -9 Left 1106895739 13:34300419-34300441 CCTGAGTCCTCAAAGGCAGAAAG No data
Right 1106895742 13:34300433-34300455 GGCAGAAAGAGAAAGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106895739 Original CRISPR CTTTCTGCCTTTGAGGACTC AGG (reversed) Intergenic
No off target data available for this crispr