ID: 1106895741

View in Genome Browser
Species Human (GRCh38)
Location 13:34300426-34300448
Sequence CCTCAAAGGCAGAAAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106895736_1106895741 17 Left 1106895736 13:34300386-34300408 CCATATTAACAAAATCTAAGTCA No data
Right 1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106895741 Original CRISPR CCTCAAAGGCAGAAAGAGAA AGG Intergenic
No off target data available for this crispr