ID: 1106895742

View in Genome Browser
Species Human (GRCh38)
Location 13:34300433-34300455
Sequence GGCAGAAAGAGAAAGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106895736_1106895742 24 Left 1106895736 13:34300386-34300408 CCATATTAACAAAATCTAAGTCA No data
Right 1106895742 13:34300433-34300455 GGCAGAAAGAGAAAGGAACCAGG No data
1106895738_1106895742 -6 Left 1106895738 13:34300416-34300438 CCTCCTGAGTCCTCAAAGGCAGA No data
Right 1106895742 13:34300433-34300455 GGCAGAAAGAGAAAGGAACCAGG No data
1106895739_1106895742 -9 Left 1106895739 13:34300419-34300441 CCTGAGTCCTCAAAGGCAGAAAG No data
Right 1106895742 13:34300433-34300455 GGCAGAAAGAGAAAGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106895742 Original CRISPR GGCAGAAAGAGAAAGGAACC AGG Intergenic
No off target data available for this crispr