ID: 1106898238

View in Genome Browser
Species Human (GRCh38)
Location 13:34328576-34328598
Sequence ATGTTGGCCGTTTCTCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106898234_1106898238 15 Left 1106898234 13:34328538-34328560 CCTGTGGCCAAGGTCAACTGTGC No data
Right 1106898238 13:34328576-34328598 ATGTTGGCCGTTTCTCTTGCAGG No data
1106898232_1106898238 29 Left 1106898232 13:34328524-34328546 CCAATGTGGTGTCTCCTGTGGCC No data
Right 1106898238 13:34328576-34328598 ATGTTGGCCGTTTCTCTTGCAGG No data
1106898235_1106898238 8 Left 1106898235 13:34328545-34328567 CCAAGGTCAACTGTGCTTGTTAG No data
Right 1106898238 13:34328576-34328598 ATGTTGGCCGTTTCTCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106898238 Original CRISPR ATGTTGGCCGTTTCTCTTGC AGG Intergenic