ID: 1106900070

View in Genome Browser
Species Human (GRCh38)
Location 13:34346403-34346425
Sequence GTGTTGGGATATTTGTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106900070_1106900078 22 Left 1106900070 13:34346403-34346425 CCAAACCACAAATATCCCAACAC No data
Right 1106900078 13:34346448-34346470 ACCAGTAGCAAAAGGAAATAAGG No data
1106900070_1106900077 14 Left 1106900070 13:34346403-34346425 CCAAACCACAAATATCCCAACAC No data
Right 1106900077 13:34346440-34346462 TCAAACTAACCAGTAGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106900070 Original CRISPR GTGTTGGGATATTTGTGGTT TGG (reversed) Intergenic
No off target data available for this crispr