ID: 1106901740

View in Genome Browser
Species Human (GRCh38)
Location 13:34360811-34360833
Sequence CTACAAAGGAACCCTGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106901740_1106901743 -7 Left 1106901740 13:34360811-34360833 CCATAGACAGGGTTCCTTTGTAG No data
Right 1106901743 13:34360827-34360849 TTTGTAGTGTGAACTGAGAAGGG No data
1106901740_1106901744 17 Left 1106901740 13:34360811-34360833 CCATAGACAGGGTTCCTTTGTAG No data
Right 1106901744 13:34360851-34360873 ATTCATCTACCTCTTCCCAGAGG No data
1106901740_1106901742 -8 Left 1106901740 13:34360811-34360833 CCATAGACAGGGTTCCTTTGTAG No data
Right 1106901742 13:34360826-34360848 CTTTGTAGTGTGAACTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106901740 Original CRISPR CTACAAAGGAACCCTGTCTA TGG (reversed) Intergenic
No off target data available for this crispr