ID: 1106905871

View in Genome Browser
Species Human (GRCh38)
Location 13:34408318-34408340
Sequence AGCCAATGTGATTACAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106905871_1106905873 -4 Left 1106905871 13:34408318-34408340 CCATCTCTGTAATCACATTGGCT No data
Right 1106905873 13:34408337-34408359 GGCTGCAGGAAAGTCTGCAAAGG No data
1106905871_1106905875 10 Left 1106905871 13:34408318-34408340 CCATCTCTGTAATCACATTGGCT No data
Right 1106905875 13:34408351-34408373 CTGCAAAGGCACAGTCTTCAGGG No data
1106905871_1106905876 29 Left 1106905871 13:34408318-34408340 CCATCTCTGTAATCACATTGGCT No data
Right 1106905876 13:34408370-34408392 AGGGACCTAACCCATATTTCAGG No data
1106905871_1106905874 9 Left 1106905871 13:34408318-34408340 CCATCTCTGTAATCACATTGGCT No data
Right 1106905874 13:34408350-34408372 TCTGCAAAGGCACAGTCTTCAGG No data
1106905871_1106905877 30 Left 1106905871 13:34408318-34408340 CCATCTCTGTAATCACATTGGCT No data
Right 1106905877 13:34408371-34408393 GGGACCTAACCCATATTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106905871 Original CRISPR AGCCAATGTGATTACAGAGA TGG (reversed) Intergenic
No off target data available for this crispr